From be634c1699c3d31c4f148e015e6302fd99e85ded Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Thu, 1 Oct 2026 18:20:32 -0600 Subject: [PATCH 01/18] add missing mondo ids and fix mondo id for FRDA + regenerate HPO terms --- data/STRchive-loci.json | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 439a64b7..6476340c 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -2061,7 +2061,7 @@ "genereviews": [], "malacard": [], "medgen": ["320250"], - "mondo": [], + "mondo": ["0025193"], "omim": ["615813"], "orphanet": ["98897"], "gnomad": ["FAM193B"], @@ -2291,7 +2291,7 @@ "inheritance": ["AR"], "association_type": ["Mendelian"], "disease_description": "Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty [@omim:229300].", - "hpo_terms": ["HP:0000505 Visual impairment", "HP:0000639 Nystagmus", "HP:0000648 Optic atrophy", "HP:0000649 Abnormality of visual evoked potentials", "HP:0000763 Sensory neuropathy", "HP:0000819 Diabetes mellitus", "HP:0001123 Visual field defect", "HP:0001251 Ataxia", "HP:0001260 Dysarthria", "HP:0001626 Abnormality of the cardiovascular system", "HP:0001635 Congestive heart failure", "HP:0001639 Hypertrophic cardiomyopathy", "HP:0001761 Pes cavus", "HP:0002066 Gait ataxia", "HP:0002070 Limb ataxia", "HP:0002495 Impaired vibratory sensation", "HP:0002522 Areflexia of lower limbs", "HP:0002650 Scoliosis", "HP:0003115 Abnormal EKG", "HP:0003209 Decreased pyruvate carboxylase activity", "HP:0003232 Mitochondrial malic enzyme reduced", "HP:0003448 Decreased sensory nerve conduction velocity", "HP:0003487 Babinski sign", "HP:0007078 Decreased amplitude of sensory action potentials", "HP:0007663 Reduced visual acuity", "HP:0010831 Impaired proprioception"], + "hpo_terms": [], "prevalence": "1/50000", "prevalence_details": "1/50,000 [@omim:229300; @pmid:29100084]: Known carrier frequency 1000/100,000; observed 421/100,000. Most common inherited ataxia in Europe, the Middle East, India, and North Africa; not documented in Southeast Asia, in sub-Saharan Africa, or among Native Americans [@genereviews:NBK1281].", "age_onset": "Typical: 10-15; Range: 2-80 [@genereviews:NBK1281].", @@ -2339,7 +2339,7 @@ "genereviews": ["NBK1281"], "malacard": ["FRD001"], "medgen": ["383962"], - "mondo": ["0100340"], + "mondo": ["0100339"], "omim": ["229300"], "orphanet": ["95"], "gnomad": ["FXN"], @@ -4809,7 +4809,7 @@ "genereviews": [], "malacard": [], "medgen": ["320250"], - "mondo": [], + "mondo": ["0025193"], "omim": ["612655"], "orphanet": ["98897"], "gnomad": [], @@ -5077,7 +5077,7 @@ "genereviews": [], "malacard": [], "medgen": ["431598"], - "mondo": [], + "mondo": ["0975800"], "omim": ["620947"], "orphanet": [], "gnomad": ["THAP11"], @@ -5715,7 +5715,7 @@ "genereviews": [], "malacard": ["ATS007"], "medgen": [], - "mondo": [], + "mondo": ["0005258"], "omim": ["616181"], "orphanet": [], "gnomad": ["ZNF713"], From 2b4f3239bc4465e4611b0341db496bb034c1df39 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Thu, 1 Oct 2026 19:03:24 -0600 Subject: [PATCH 02/18] add HPO terms for new mondo ids --- data/STRchive-loci.json | 14 +++++++------- 1 file changed, 7 insertions(+), 7 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 6476340c..c6809fd0 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -322,7 +322,7 @@ "malacard": ["ERL057"], "medgen": ["483052"], "mondo": ["0010632"], - "omim": ["308350", "300419", "300215"], + "omim": ["308350", "300419"], "orphanet": ["182079"], "gnomad": ["ARX_1"], "stripy": ["ARX_1"], @@ -2023,7 +2023,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "This is a newly proposed locus for OPDM, it does not have a type number yet and has not been validated. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0008997 Proximal upper limb muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0010550 Paraplegia", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle", "HP:3000010 Abnormality of orbicularis oris muscle"], "prevalence": null, "prevalence_details": "Found in two siblings in a UDN family [@pmid:38297326; @pmid:40357124].", "age_onset": "49-51 based on two siblings [@pmid:39868092].", @@ -2291,7 +2291,7 @@ "inheritance": ["AR"], "association_type": ["Mendelian"], "disease_description": "Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty [@omim:229300].", - "hpo_terms": [], + "hpo_terms": ["HP:0000012 Urinary urgency", "HP:0000365 Hearing impairment", "HP:0000570 Abnormal saccadic eye movements", "HP:0000639 Nystagmus", "HP:0000648 Optic atrophy", "HP:0000716 Depression", "HP:0000739 Anxiety", "HP:0000819 Diabetes mellitus", "HP:0001063 Acrocyanosis", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001272 Cerebellar atrophy", "HP:0001310 Dysmetria", "HP:0001324 Muscle weakness", "HP:0001332 Dystonia", "HP:0001618 Dysphonia", "HP:0001638 Cardiomyopathy", "HP:0001760 Abnormal foot morphology", "HP:0001761 Pes cavus", "HP:0001762 Talipes equinovarus", "HP:0002015 Dysphagia", "HP:0002037 Inflammation of the large intestine", "HP:0002066 Gait ataxia", "HP:0002070 Limb ataxia", "HP:0002072 Chorea", "HP:0002075 Dysdiadochokinesis", "HP:0002080 Intention tremor", "HP:0002141 Gait imbalance", "HP:0002270 Abnormality of the autonomic nervous system", "HP:0002312 Clumsiness", "HP:0002495 Impaired vibratory sensation", "HP:0002522 Areflexia of lower limbs", "HP:0002527 Falls", "HP:0002540 Inability to walk", "HP:0002546 Incomprehensible speech", "HP:0002650 Scoliosis", "HP:0002839 Urinary bladder sphincter dysfunction", "HP:0003115 Abnormal EKG", "HP:0003390 Sensory axonal neuropathy", "HP:0003394 Muscle spasm", "HP:0003431 Decreased motor nerve conduction velocity", "HP:0003487 Babinski sign", "HP:0004349 Reduced bone mineral density", "HP:0007010 Poor fine motor coordination", "HP:0007663 Reduced visual acuity", "HP:0009130 Hand muscle atrophy", "HP:0010535 Sleep apnea", "HP:0010831 Impaired proprioception", "HP:0010873 Cervical spinal cord atrophy", "HP:0012079 Abnormality of central motor conduction", "HP:0012452 Restless legs", "HP:0025402 Square-wave jerks", "HP:0030183 Impaired visually enhanced vestibulo-ocular reflex"], "prevalence": "1/50000", "prevalence_details": "1/50,000 [@omim:229300; @pmid:29100084]: Known carrier frequency 1000/100,000; observed 421/100,000. Most common inherited ataxia in Europe, the Middle East, India, and North Africa; not documented in Southeast Asia, in sub-Saharan Africa, or among Native Americans [@genereviews:NBK1281].", "age_onset": "Typical: 10-15; Range: 2-80 [@genereviews:NBK1281].", @@ -4031,7 +4031,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Inherited or familial Creutzfeldt-Jakob disease (fCJD) and Gerstmann-Straussler-Scheinker syndrome (GSS) are rare forms of genetic prion disease characterized by cognitive difficulties, ataxia, and myoclonus [@genereviews:NBK1229]. These diseases are associated with the larger Prion Disease phenotypic spectrum, but other phenotypes have not been associated with this tandem repeat [@doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1].", - "hpo_terms": ["HP:0000504 Abnormality of vision", "HP:0000505 Visual impairment", "HP:0000605 Supranuclear gaze palsy", "HP:0000639 Nystagmus", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000726 Dementia", "HP:0000736 Short attention span", "HP:0000737 Irritability", "HP:0000738 Hallucinations", "HP:0000739 Anxiety", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0000751 Personality changes", "HP:0001250 Seizure", "HP:0001262 Excessive daytime somnolence", "HP:0001269 Hemiparesis", "HP:0001289 Confusion", "HP:0001317 Abnormal cerebellum morphology", "HP:0001324 Muscle weakness", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001350 Slurred speech", "HP:0002066 Gait ataxia", "HP:0002067 Bradykinesia", "HP:0002072 Chorea", "HP:0002073 Progressive cerebellar ataxia", "HP:0002283 Global brain atrophy", "HP:0002312 Clumsiness", "HP:0002354 Memory impairment", "HP:0002381 Aphasia", "HP:0002401 Stroke-like episode", "HP:0002446 Astrocytosis", "HP:0002464 Spastic dysarthria", "HP:0002529 Neuronal loss in central nervous system", "HP:0002922 Increased CSF protein concentration", "HP:0003487 Babinski sign", "HP:0005327 Loss of facial expression", "HP:0006943 Diffuse spongiform leukoencephalopathy", "HP:0007009 Central nervous system degeneration", "HP:0007017 Progressive forgetfulness", "HP:0007076 Extrapyramidal muscular rigidity", "HP:0007158 Progressive extrapyramidal muscular rigidity", "HP:0007183 Focal T2 hyperintense basal ganglia lesion", "HP:0007256 Abnormal pyramidal sign", "HP:0007686 Abnormal pupillary function", "HP:0010542 Vestibular nystagmus", "HP:0010846 EEG with persistent abnormal rhythmic activity", "HP:0011099 Spastic hemiparesis", "HP:0012332 Abnormal autonomic nervous system physiology", "HP:0012672 Akinetic mutism", "HP:0025152 Poor visual behavior for age", "HP:0100256 Senile plaques", "HP:0100292 Amyloidosis of peripheral nerves", "HP:0100661 Trigeminal neuralgia", "HP:0100785 Insomnia"], + "hpo_terms": ["HP:0000504 Abnormality of vision", "HP:0000505 Visual impairment", "HP:0000605 Supranuclear gaze palsy", "HP:0000639 Nystagmus", "HP:0000709 Psychosis", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000718 Aggressive behavior", "HP:0000726 Dementia", "HP:0000736 Short attention span", "HP:0000737 Irritability", "HP:0000738 Hallucinations", "HP:0000739 Anxiety", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0000751 Personality changes", "HP:0001250 Seizure", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001262 Excessive daytime somnolence", "HP:0001268 Mental deterioration", "HP:0001269 Hemiparesis", "HP:0001272 Cerebellar atrophy", "HP:0001284 Areflexia", "HP:0001289 Confusion", "HP:0001300 Parkinsonism", "HP:0001315 Diminished deep tendon reflex", "HP:0001317 Abnormal cerebellum morphology", "HP:0001324 Muscle weakness", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001347 Hyperreflexia", "HP:0001350 Slurred speech", "HP:0001824 Weight loss", "HP:0002062 Abnormal pyramidal tract morphology", "HP:0002063 Rigidity", "HP:0002066 Gait ataxia", "HP:0002067 Bradykinesia", "HP:0002070 Limb ataxia", "HP:0002071 Abnormality of extrapyramidal motor function", "HP:0002072 Chorea", "HP:0002073 Progressive cerebellar ataxia", "HP:0002078 Truncal ataxia", "HP:0002185 Neurofibrillary tangles", "HP:0002186 Apraxia", "HP:0002283 Global brain atrophy", "HP:0002312 Clumsiness", "HP:0002354 Memory impairment", "HP:0002360 Sleep disturbance", "HP:0002381 Aphasia", "HP:0002401 Stroke-like episode", "HP:0002446 Astrocytosis", "HP:0002464 Spastic dysarthria", "HP:0002529 Neuronal loss in central nervous system", "HP:0002922 Increased CSF protein concentration", "HP:0003401 Paresthesia", "HP:0003487 Babinski sign", "HP:0005327 Loss of facial expression", "HP:0006943 Diffuse spongiform leukoencephalopathy", "HP:0007009 Central nervous system degeneration", "HP:0007017 Progressive forgetfulness", "HP:0007076 Extrapyramidal muscular rigidity", "HP:0007158 Progressive extrapyramidal muscular rigidity", "HP:0007183 Focal T2 hyperintense basal ganglia lesion", "HP:0007256 Abnormal pyramidal sign", "HP:0007340 Lower limb muscle weakness", "HP:0007686 Abnormal pupillary function", "HP:0007772 Impaired smooth pursuit", "HP:0010542 Vestibular nystagmus", "HP:0010846 EEG with persistent abnormal rhythmic activity", "HP:0011099 Spastic hemiparesis", "HP:0011730 Abnormal central sensory function", "HP:0012332 Abnormal autonomic nervous system physiology", "HP:0012534 Dysesthesia", "HP:0012672 Akinetic mutism", "HP:0025152 Poor visual behavior for age", "HP:0030223 Perseverative thought", "HP:0031006 Acroparesthesia", "HP:0045084 Limb myoclonus", "HP:0100256 Senile plaques", "HP:0100292 Amyloidosis of peripheral nerves", "HP:0100543 Cognitive impairment", "HP:0100661 Trigeminal neuralgia", "HP:0100785 Insomnia", "HP:0410263 Brain imaging abnormality"], "prevalence": null, "prevalence_details": "<0.0225/1,000,000: <15% of CJ variants are repeat expansions [@genereviews:NBK535148]. 15% of newly diagnosed prion disease cases are genetic [@genereviews:NBK1229], 1 individual per million per year worldwide (350 cases annually in US) [@pmid:29939637]. Found worldwide [@genereviews:NBK1229].", "age_onset": "Typical: 50-60 [@genereviews:NBK1229]; Range: 31-63 [@pmid:37379724].", @@ -4079,7 +4079,7 @@ "genereviews": ["NBK1229"], "malacard": ["CRT072"], "medgen": ["155837"], - "mondo": ["0007403"], + "mondo": ["0007403", "0007656"], "omim": ["123400"], "orphanet": ["282166"], "gnomad": ["PRNP"], @@ -4771,7 +4771,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "This is a newly proposed locus for OPDM, only having been reported in one paper [@pmid:41959811]. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0008997 Proximal upper limb muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0010550 Paraplegia", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle", "HP:3000010 Abnormality of orbicularis oris muscle"], "prevalence": null, "prevalence_details": "Found in 3 families (7 total patients) of European ancestry [@pmid:41959811].", "age_onset": "2nd to 6th decade (3/5 patients had onset in 2nd decade). Referred to as adult onset, so assuming high end of 2nd decade [@pmid:41959811].", @@ -5039,7 +5039,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "THAP11-caused SCA involves symptoms including gait ataxia, dysarthria, dysphagia, slow saccades, ptosis, and/or nystagmus [@pmid:37148549].", - "hpo_terms": null, + "hpo_terms": ["HP:0000508 Ptosis", "HP:0000514 Slow saccadic eye movements", "HP:0000639 Nystagmus", "HP:0001251 Ataxia", "HP:0001260 Dysarthria", "HP:0001336 Myoclonus", "HP:0002015 Dysphagia", "HP:0002066 Gait ataxia", "HP:0003474 Somatic sensory dysfunction", "HP:0007256 Abnormal pyramidal sign", "HP:0100543 Cognitive impairment"], "prevalence": null, "prevalence_details": "Has been observed in Chinese families [@pmid:37148549; @pmid:24677642]. Interruptions predisposing to expansion/disease appear to vary by ancestry [@pmid:39651830].", "age_onset": "Typical: 8-40 (small sample size); Range: 4-51 [@pmid:37148549].", From 193884685cbe2c095e858b190a636af5344040ee Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Thu, 1 Oct 2026 19:57:24 -0600 Subject: [PATCH 03/18] Update MONDO/OMIM and HPO annotations for FTDALS1_C9orf72, ALS1_NIPA1, CJD_PRNP, and XLID_SOX3 --- data/STRchive-loci.json | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index c6809fd0..33873bf6 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -1040,7 +1040,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian", "Risk"], "disease_description": "Pure frontotemporal dementia, pure amyotrophic lateral sclerosis or combination of the two [@pmid:39349043]. Nominal associations with risk of Parkinson's have also been reported [@pmid:41074692]. May present as non-Huntington chorea in rare cases [@pmid:41957010].", - "hpo_terms": ["HP:0000605 Supranuclear gaze palsy", "HP:0000716 Depression", "HP:0000726 Dementia", "HP:0000738 Hallucinations", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0001260 Dysarthria", "HP:0001300 Parkinsonism", "HP:0001324 Muscle weakness", "HP:0002059 Cerebral atrophy", "HP:0002145 Frontotemporal dementia", "HP:0002171 Gliosis", "HP:0002186 Apraxia", "HP:0002273 Tetraparesis", "HP:0002366 Abnormal lower motor neuron morphology", "HP:0002385 Paraparesis", "HP:0002442 Dyscalculia", "HP:0002529 Neuronal loss in central nervous system", "HP:0003202 Skeletal muscle atrophy", "HP:0007308 Extrapyramidal dyskinesia", "HP:0007354 Amyotrophic lateral sclerosis"], + "hpo_terms": ["HP:0000217 Xerostomia", "HP:0000605 Supranuclear gaze palsy", "HP:0000708 Atypical behavior", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000726 Dementia", "HP:0000738 Hallucinations", "HP:0000739 Anxiety", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001300 Parkinsonism", "HP:0001308 Tongue fasciculations", "HP:0001324 Muscle weakness", "HP:0001347 Hyperreflexia", "HP:0001618 Dysphonia", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002059 Cerebral atrophy", "HP:0002094 Dyspnea", "HP:0002145 Frontotemporal dementia", "HP:0002171 Gliosis", "HP:0002180 Neurodegeneration", "HP:0002186 Apraxia", "HP:0002273 Tetraparesis", "HP:0002307 Drooling", "HP:0002313 Spastic paraparesis", "HP:0002360 Sleep disturbance", "HP:0002366 Abnormal lower motor neuron morphology", "HP:0002380 Fasciculations", "HP:0002385 Paraparesis", "HP:0002442 Dyscalculia", "HP:0002463 Language impairment", "HP:0002529 Neuronal loss in central nervous system", "HP:0002878 Respiratory failure", "HP:0003202 Skeletal muscle atrophy", "HP:0003324 Generalized muscle weakness", "HP:0003376 Steppage gait", "HP:0003394 Muscle spasm", "HP:0003470 Paralysis", "HP:0003484 Upper limb muscle weakness", "HP:0003487 Babinski sign", "HP:0003693 Distal amyotrophy", "HP:0004326 Cachexia", "HP:0007308 Extrapyramidal dyskinesia", "HP:0007340 Lower limb muscle weakness", "HP:0007354 Amyotrophic lateral sclerosis", "HP:0007373 Motor neuron atrophy", "HP:0008955 Progressive distal muscular atrophy", "HP:0009027 Foot dorsiflexor weakness", "HP:0012378 Fatigue", "HP:0012473 Tongue atrophy", "HP:0012531 Pain", "HP:0012764 Orthopnea", "HP:0025425 Laryngospasm", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030195 Fatigable weakness of swallowing muscles", "HP:0030196 Fatigable weakness of respiratory muscles", "HP:0030878 Abnormality on pulmonary function testing", "HP:0031993 Hoffmann sign", "HP:0033683 Jaw hyperreflexia", "HP:0100543 Cognitive impairment"], "prevalence": null, "prevalence_details": "The expansion of a hexanucleotide repeat GGGGCC in C9orf72 is the most common known cause of ALS accounting for ~ 40% familial cases and ~ 7% sporadic cases in the European population; overall ALS incidence is 1-2/100,000 person-years, point prevalence is 3-5/100,000 (Europe/US); lifetime risk is 1 in 300 [@pmid:31315673]. Relatives of patients with C9orf72-ALS appear at an increased risk of disease regardless of carrier status [@pmid:38149039; @pmid:39315390]. C9orf72-FTD is estimated to be 0.04-134:100,000 [@genereviews:NBK268647], and by our estimates 0.65-1.56/100,000 for C9orf72-ALS. The expansion has been found across ethnicities/ancestries, with population-dependent prevalence, highest in those with northern European ancestry [@genereviews:NBK268647].", "age_onset": "Typical: 50-64; Range: 20-91 [@genereviews:NBK268647].", @@ -1078,7 +1078,7 @@ "genereviews": ["NBK268647"], "malacard": ["FRN044"], "medgen": ["1830423"], - "mondo": ["0007105"], + "mondo": ["0007105", "0004976"], "omim": ["105550"], "orphanet": ["275872"], "gnomad": ["C9ORF72"], @@ -3336,7 +3336,7 @@ "inheritance": ["AD"], "association_type": ["Modifier"], "disease_description": "Amyotrophic lateral sclerosis is a neurodegenerative disorder characterized by the death of motor neurons in the brain, brainstem, and spinal cord, resulting in fatal paralysis. ALS usually begins with asymmetric involvement of the muscles in middle adult life [@omim:105400].", - "hpo_terms": ["HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001324 Muscle weakness", "HP:0001347 Hyperreflexia", "HP:0002015 Dysphagia", "HP:0002314 Degeneration of the lateral corticospinal tracts", "HP:0002380 Fasciculations", "HP:0002398 Degeneration of anterior horn cells", "HP:0003202 Skeletal muscle atrophy", "HP:0003394 Muscle spasm", "HP:0007024 Pseudobulbar paralysis", "HP:0007354 Amyotrophic lateral sclerosis", "HP:0010535 Sleep apnea"], + "hpo_terms": ["HP:0000217 Xerostomia", "HP:0000708 Atypical behavior", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000739 Anxiety", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001308 Tongue fasciculations", "HP:0001347 Hyperreflexia", "HP:0001618 Dysphonia", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002094 Dyspnea", "HP:0002145 Frontotemporal dementia", "HP:0002180 Neurodegeneration", "HP:0002307 Drooling", "HP:0002313 Spastic paraparesis", "HP:0002360 Sleep disturbance", "HP:0002380 Fasciculations", "HP:0002463 Language impairment", "HP:0002878 Respiratory failure", "HP:0003202 Skeletal muscle atrophy", "HP:0003324 Generalized muscle weakness", "HP:0003376 Steppage gait", "HP:0003394 Muscle spasm", "HP:0003470 Paralysis", "HP:0003484 Upper limb muscle weakness", "HP:0003487 Babinski sign", "HP:0003693 Distal amyotrophy", "HP:0004326 Cachexia", "HP:0007340 Lower limb muscle weakness", "HP:0007354 Amyotrophic lateral sclerosis", "HP:0007373 Motor neuron atrophy", "HP:0008955 Progressive distal muscular atrophy", "HP:0009027 Foot dorsiflexor weakness", "HP:0012378 Fatigue", "HP:0012473 Tongue atrophy", "HP:0012531 Pain", "HP:0012764 Orthopnea", "HP:0025425 Laryngospasm", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030195 Fatigable weakness of swallowing muscles", "HP:0030196 Fatigable weakness of respiratory muscles", "HP:0030878 Abnormality on pulmonary function testing", "HP:0031993 Hoffmann sign", "HP:0033683 Jaw hyperreflexia", "HP:0100543 Cognitive impairment"], "prevalence": null, "prevalence_details": "2.7-7.4/100,000 for all cases of ALS, NIPA1 + C9orf72 is 0.37% of ALS patients; frequency of NIPA1 expansion in controls is 3.74% [@pmid:31286297]. The NIPA1 expansion is associated with disease globally [@pmid:30342764], but likely unassociated in African probands [@pmid:34179866].", "age_onset": "Typical: 44-60 [@pmid:26777436]; Range: 25 [@pmid:22378146] - 77 [@pmid:26777436].", @@ -3374,7 +3374,7 @@ "genereviews": [], "malacard": ["FRN044"], "medgen": ["400169"], - "mondo": ["0007103"], + "mondo": ["0004976"], "omim": ["105400"], "orphanet": ["282", "803"], "gnomad": ["NIPA1"], @@ -4080,7 +4080,7 @@ "malacard": ["CRT072"], "medgen": ["155837"], "mondo": ["0007403", "0007656"], - "omim": ["123400"], + "omim": ["123400", "137440"], "orphanet": ["282166"], "gnomad": ["PRNP"], "stripy": [], @@ -4598,7 +4598,7 @@ "genereviews": ["NBK535148"], "malacard": ["PNH005", "INT405"], "medgen": ["394771"], - "mondo": ["0010252"], + "mondo": ["0010252", "0800474"], "omim": ["300123", "312000"], "orphanet": ["67045"], "gnomad": ["SOX3"], From bf0e8442655866e35a1f4562eb5dc918ef08a871 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 10:03:25 -0600 Subject: [PATCH 04/18] added autism mondo id to FRA7A_ZNF713 and updated hpo terms --- data/STRchive-loci.json | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 33873bf6..179870b1 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -5677,7 +5677,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "A spectrum of developmental disorders that includes autism and Asperger syndrome. Signs and symptoms include poor communication skills, defective social interactions, and repetitive behaviors [@mondo:0005258].", - "hpo_terms": null, + "hpo_terms": ["HP:0000717 Autism", "HP:0000721 Lack of spontaneous play", "HP:0000723 Restrictive behavior", "HP:0000728 Reduced ability to form peer relationships", "HP:0000732 Inflexible adherence to routines", "HP:0000733 Motor stereotypy", "HP:0000750 Delayed speech and language development", "HP:0000758 Abnormal nonverbal communicative behavior", "HP:0001249 Intellectual disability", "HP:0001250 Seizure", "HP:0002353 EEG abnormality", "HP:0003144 Increased serum serotonin"], "prevalence": null, "prevalence_details": "1 proband reported alongside 3 individuals with premutations, found in 2 families without discussion of ancestry/ethnicity [@pmid:25196122].", "age_onset": "2-3 (four individuals) [@pmid:25196122].", @@ -5715,7 +5715,7 @@ "genereviews": [], "malacard": ["ATS007"], "medgen": [], - "mondo": ["0005258"], + "mondo": ["0005258", "0005260"], "omim": ["616181"], "orphanet": [], "gnomad": ["ZNF713"], From 22ea78d2f5c5dbb1a1ef5e0c0ba4476c6456a2b2 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 17:56:20 -0600 Subject: [PATCH 05/18] Use the more specific MONDO ID for FRDA_FXN MONDO:0100339 "Friedreich ataxia" -> MONDO:0100340 "Friedreich ataxia 1" (OMIM 229300, the FXN form). Co-Authored-By: Claude Opus 5.5 --- data/STRchive-loci.json | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 179870b1..d87fc22a 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -2339,7 +2339,7 @@ "genereviews": ["NBK1281"], "malacard": ["FRD001"], "medgen": ["383962"], - "mondo": ["0100339"], + "mondo": ["0100340"], "omim": ["229300"], "orphanet": ["95"], "gnomad": ["FXN"], From 53c852e0e2f4096f251031e951af8957fe7f400b Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 17:56:20 -0600 Subject: [PATCH 06/18] Fetch HPO terms from HPO annotations using OMIM and Orphanet IDs getHPO.py now reads phenotype.hpoa for each locus's OMIM and Orphanet IDs instead of Monarch associations for its MONDO IDs, so phenotypes no longer change when a MONDO ID is swapped. Term names come from hp.json. - All OMIM annotations are kept (they rarely record a frequency) - Orphanet annotations are limited by --orphanet-min-frequency (default: occasional, >=5% of patients) - NOT (absent) annotations are excluded - New --replace option rebuilds lists instead of adding to them Document how hpo_terms are populated in the loci schema. Co-Authored-By: Claude Opus 5.5 --- data/STRchive-loci.schema.json | 2 +- scripts/getHPO.py | 126 ++++++++++++++++++++++----------- 2 files changed, 86 insertions(+), 42 deletions(-) diff --git a/data/STRchive-loci.schema.json b/data/STRchive-loci.schema.json index 17ad6a1a..a9379349 100644 --- a/data/STRchive-loci.schema.json +++ b/data/STRchive-loci.schema.json @@ -166,7 +166,7 @@ "hpo_terms": { "section": "Disease", "title": "HPO Terms", - "description": "Human Phenotype Ontology (HPO) terms associated with the disease", + "description": "Human Phenotype Ontology (HPO) terms associated with the disease. Populated automatically by scripts/getHPO.py from the HPO annotations (phenotype.hpoa) for the locus's OMIM and Orphanet IDs: all OMIM annotations, plus Orphanet annotations seen in at least 5% of patients (frequency occasional or higher). Excludes terms annotated as absent (NOT).", "examples": ["HP:0002066 Gait ataxia", "HP:0001250 Seizure"], "type": ["array", "null"], "items": { diff --git a/scripts/getHPO.py b/scripts/getHPO.py index 78371382..8da2922b 100644 --- a/scripts/getHPO.py +++ b/scripts/getHPO.py @@ -1,6 +1,11 @@ #!/usr/bin/env python3 """ Add HPO terms to STRchive-loci.json. + +Terms come from the HPO annotations (phenotype.hpoa) for each locus's OMIM and +Orphanet ids. Orphanet annotations are limited to terms at or above a minimum +frequency (default: occasional, i.e. >=5% of patients). OMIM annotations rarely +record a frequency, so all are kept. Term names come from the HPO ontology. """ import argparse import json @@ -9,11 +14,23 @@ import jsbeautifier import pandas as pd +import requests REPO = Path(__file__).resolve().parent.parent LOCI_PATH = REPO / "data" / "STRchive-loci.json" -HPO_URL = ("https://data.monarchinitiative.org/monarch-kg/latest/tsv/all_associations/disease_to_phenotypic_feature_association.all.tsv.gz") +HPO_RELEASE = "https://github.com/obophenotype/human-phenotype-ontology/releases/latest/download" +HPOA_URL = f"{HPO_RELEASE}/phenotype.hpoa" +HPO_ONTOLOGY_URL = f"{HPO_RELEASE}/hp.json" + +# HPO frequency terms used by Orphanet annotations, most to least frequent +ORPHANET_FREQUENCIES = { + "obligate": "HP:0040280", # 100% + "very-frequent": "HP:0040281", # 80-99% + "frequent": "HP:0040282", # 30-79% + "occasional": "HP:0040283", # 5-29% + "very-rare": "HP:0040284", # 1-4% +} def write_loci(loci, loci_path): """Write loci to path""" @@ -24,64 +41,79 @@ def write_loci(loci, loci_path): fh.write(jsbeautifier.beautify(json.dumps(loci, ensure_ascii=False), options)) fh.write("\n") -def normalise_mondo(m): - """add 'mondo' to name""" - if m is None: +def normalise_id(value, prefix): + """add prefix e.g. 'OMIM:' to id""" + if value is None: return None - m = str(m).strip() - if not m: + value = str(value).strip() + if not value: return None - return m if m.startswith("MONDO:") else f"MONDO:{m}" + return value if value.startswith(prefix) else f"{prefix}{value}" def as_list(value): if value is None: return [] return value if isinstance(value, list) else [value] -def load_monarch(): - """mondo id to {HPO id: HPO name}.""" - hpo = pd.read_csv( - HPO_URL, - sep="\t", - usecols=["subject", "object", "object_label"], - dtype=str, - ) - hpo = hpo.loc[ - hpo["subject"].str.startswith("MONDO:", na=False) - & hpo["object"].str.startswith("HP:", na=False) - & hpo["object_label"].notna() +def load_hpo_names(): + """HPO id to HPO name.""" + graph = requests.get(HPO_ONTOLOGY_URL, timeout=120).json()["graphs"][0] + names = {} + for node in graph["nodes"]: + if node.get("lbl") and "/HP_" in node["id"]: + names[node["id"].rsplit("/", 1)[1].replace("_", ":")] = node["lbl"] + return names + +def load_annotations(min_frequency, hpo_names): + """disease id (OMIM:/ORPHA:) to {HPO id: HPO name}.""" + levels = list(ORPHANET_FREQUENCIES) + keep = {ORPHANET_FREQUENCIES[f] for f in levels[: levels.index(min_frequency) + 1]} + hpoa = pd.read_csv(HPOA_URL, sep="\t", comment="#", dtype=str) + is_omim = hpoa["database_id"].str.startswith("OMIM:", na=False) + is_orpha = hpoa["database_id"].str.startswith("ORPHA:", na=False) + hpoa = hpoa.loc[ + hpoa["qualifier"].isna() # skip "NOT" annotations + & (hpoa["aspect"] == "P") # phenotypic abnormalities only + & (is_omim | (is_orpha & hpoa["frequency"].isin(keep))) ] - mondo_to_hpo = {} - for mondo, hpo_id, hpo_name in hpo[ - ["subject", "object", "object_label"] - ].itertuples(index=False): - mondo_to_hpo.setdefault(mondo, {})[hpo_id] = hpo_name - return mondo_to_hpo - -def annotate(loci, mondo_to_hpo): + disease_to_hpo = {} + missing = set() + for disease, hpo_id in hpoa[["database_id", "hpo_id"]].itertuples(index=False): + if hpo_id not in hpo_names: + missing.add(hpo_id) + continue + disease_to_hpo.setdefault(disease, {})[hpo_id] = hpo_names[hpo_id] + if missing: + print(f"WARNING: skipped {len(missing)} HPO terms with no name in the ontology", file=sys.stderr) + return disease_to_hpo + +def annotate(loci, disease_to_hpo, replace=False): """Set hpo terms in place.""" - n_annotated = n_changed = n_no_mondo = 0 + n_annotated = n_changed = n_no_ids = 0 for locus in loci: before = locus.get("hpo_terms") terms = {} - for existing in as_list(before): - existing = str(existing).strip() - if existing: - terms[existing.split()[0]] = existing - - mondos = list(filter(None, map(normalise_mondo, as_list(locus.get("mondo"))))) - if not mondos: - n_no_mondo += 1 - for mondo in mondos: - for hpo_id, hpo_name in mondo_to_hpo.get(mondo, {}).items(): + if not replace: + for existing in as_list(before): + existing = str(existing).strip() + if existing: + terms[existing.split()[0]] = existing + + diseases = [normalise_id(i, "OMIM:") for i in as_list(locus.get("omim"))] + diseases += [normalise_id(i, "ORPHA:") for i in as_list(locus.get("orphanet"))] + diseases = list(filter(None, diseases)) + if not diseases: + n_no_ids += 1 + for disease in diseases: + for hpo_id, hpo_name in disease_to_hpo.get(disease, {}).items(): terms[hpo_id] = f"{hpo_id} {hpo_name}" after = sorted(terms.values()) or before locus["hpo_terms"] = after n_annotated += bool(after) n_changed += after != before - return n_annotated, n_changed, n_no_mondo + return n_annotated, n_changed, n_no_ids def main(): parser = argparse.ArgumentParser( @@ -93,6 +125,17 @@ def main(): default=LOCI_PATH, help="path to STRchive-loci.json (default: %(default)s)", ) + parser.add_argument( + "--orphanet-min-frequency", + choices=list(ORPHANET_FREQUENCIES), + default="occasional", + help="least frequent Orphanet annotation to include (default: %(default)s)", + ) + parser.add_argument( + "--replace", + action="store_true", + help="replace existing hpo terms instead of adding to them", + ) args = parser.parse_args() loci_path = args.loci.resolve() if not loci_path.exists(): @@ -100,11 +143,12 @@ def main(): with open(loci_path) as fh: loci = json.load(fh) - n_annotated, n_changed, n_no_mondo = annotate(loci, load_monarch()) + disease_to_hpo = load_annotations(args.orphanet_min_frequency, load_hpo_names()) + n_annotated, n_changed, n_no_ids = annotate(loci, disease_to_hpo, args.replace) print(f"Loci: {len(loci)}") print(f" with HPO terms after update: {n_annotated}") print(f" hpo terms changed: {n_changed}") - print(f" no mondo id: {n_no_mondo}") + print(f" no omim or orphanet id: {n_no_ids}") write_loci(loci, loci_path) print(f"Wrote {loci_path}") From aa584df0901b8ad6c187f416e203f42c382365ed Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 17:56:21 -0600 Subject: [PATCH 07/18] Update Orphanet and OMIM cross-references - CJD_PRNP: add ORPHA:356 (Gerstmann-Straussler-Scheinker syndrome) - EIEE1_ARX: add ORPHA:1934 (early infantile developmental and epileptic encephalopathy) alongside the ARX-specific ORPHA:182079 - SCA7_ATXN7: add ORPHA:208508 (autosomal dominant cerebellar ataxia type II) - CANVAS_RFC1: add OMIM 608088 and ORPHA:139564 (HSAN type 1B, sensory neuropathy with chronic cough, now known to be RFC1-related) - ALS1_NIPA1: remove ORPHA:282 (frontotemporal dementia) Co-Authored-By: Claude Opus 5.5 --- data/STRchive-loci.json | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index d87fc22a..4b775b9b 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -323,7 +323,7 @@ "medgen": ["483052"], "mondo": ["0010632"], "omim": ["308350", "300419"], - "orphanet": ["182079"], + "orphanet": ["182079", "1934"], "gnomad": ["ARX_1"], "stripy": ["ARX_1"], "tr_atlas": ["TR167317"], @@ -802,7 +802,7 @@ "medgen": ["156006"], "mondo": ["0016163"], "omim": ["164500"], - "orphanet": ["94147"], + "orphanet": ["94147", "208508"], "gnomad": ["ATXN7"], "stripy": ["ATXN7"], "tr_atlas": ["TR31879", "TR31880"], @@ -3376,7 +3376,7 @@ "medgen": ["400169"], "mondo": ["0004976"], "omim": ["105400"], - "orphanet": ["282", "803"], + "orphanet": ["803"], "gnomad": ["NIPA1"], "stripy": ["NIPA1"], "tr_atlas": ["TR133649"], @@ -4081,7 +4081,7 @@ "medgen": ["155837"], "mondo": ["0007403", "0007656"], "omim": ["123400", "137440"], - "orphanet": ["282166"], + "orphanet": ["282166", "356"], "gnomad": ["PRNP"], "stripy": [], "tr_atlas": ["TR157963", "TR157964"], @@ -4311,8 +4311,8 @@ "malacard": ["CRB196"], "medgen": ["482853"], "mondo": ["0044720"], - "omim": ["614575"], - "orphanet": ["504476"], + "omim": ["614575", "608088"], + "orphanet": ["504476", "139564"], "gnomad": ["RFC1"], "stripy": ["RFC1"], "tr_atlas": ["TR42349"], From 63e0d10a7b000b9a82225fb735e84a31d54ed01a Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 17:56:21 -0600 Subject: [PATCH 08/18] Regenerate HPO terms from OMIM and Orphanet annotations Ran getHPO.py --replace once to rebuild all lists with the new sources; regular pipeline runs only add terms. 31 loci changed: 371 terms added, 78 removed. Most removals are Orphanet terms rated very rare (1-4%), e.g. the cancers listed for DM1_DMPK, and general ALS terms on FTDALS1_C9orf72 that came only from its broad ALS MONDO term. Co-Authored-By: Claude Opus 5.5 --- data/STRchive-loci.json | 62 ++++++++++++++++++++--------------------- 1 file changed, 31 insertions(+), 31 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 4b775b9b..1bf36187 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -15,7 +15,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0008997 Proximal upper limb muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0010550 Paraplegia", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle", "HP:3000010 Abnormality of orbicularis oris muscle"], + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle"], "prevalence": null, "prevalence_details": "Found in individuals of European, Japanese, and Chinese ancestry [@pmid:38876750; @pmid:34047774].", "age_onset": "Typical: 24-30; Range: 10-50 [@pmid:39068203]. Age of onset data is limited to 8 families.", @@ -216,7 +216,7 @@ "inheritance": ["XR"], "association_type": ["Mendelian"], "disease_description": "Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting [@mondo:0010735].", - "hpo_terms": ["HP:0000029 Testicular atrophy", "HP:0000144 Decreased fertility", "HP:0000153 Abnormality of the mouth", "HP:0000763 Sensory neuropathy", "HP:0000771 Gynecomastia", "HP:0001252 Hypotonia", "HP:0001260 Dysarthria", "HP:0001265 Hyporeflexia", "HP:0001283 Bulbar palsy", "HP:0001288 Gait disturbance", "HP:0001337 Tremor", "HP:0001618 Dysphonia", "HP:0002015 Dysphagia", "HP:0002380 Fasciculations", "HP:0003119 Abnormal circulating lipid concentration", "HP:0003202 Skeletal muscle atrophy", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003394 Muscle spasm", "HP:0003560 Muscular dystrophy", "HP:0003690 Limb muscle weakness", "HP:0005978 Type II diabetes mellitus", "HP:0008981 Calf muscle hypertrophy", "HP:0009830 Peripheral neuropathy", "HP:0100022 Abnormality of movement", "HP:0100639 Erectile dysfunction"], + "hpo_terms": ["HP:0000029 Testicular atrophy", "HP:0000144 Decreased fertility", "HP:0000153 Abnormality of the mouth", "HP:0000763 Sensory neuropathy", "HP:0000771 Gynecomastia", "HP:0001252 Hypotonia", "HP:0001260 Dysarthria", "HP:0001265 Hyporeflexia", "HP:0001283 Bulbar palsy", "HP:0001288 Gait disturbance", "HP:0001337 Tremor", "HP:0001618 Dysphonia", "HP:0002015 Dysphagia", "HP:0002380 Fasciculations", "HP:0003119 Abnormal circulating lipid concentration", "HP:0003202 Skeletal muscle atrophy", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003394 Muscle spasm", "HP:0003690 Limb muscle weakness", "HP:0005978 Type II diabetes mellitus", "HP:0008981 Calf muscle hypertrophy", "HP:0009830 Peripheral neuropathy", "HP:0100022 Abnormality of movement", "HP:0100639 Erectile dysfunction"], "prevalence": "1/30000", "prevalence_details": "1-2/100,000 (population-specific, higher in Finnish population, Canadian population) [@pmid:37628685]; 1/30,000 [@orphanet:481]; mutation frequency of 1:3182 10x more frequent than reported disease prevalence of 1 in 30,000 [@pmid:36797998]. Only documented in patients with European/Asian ancestry, including Scandinavian, English, Belgian, French, Italian, German, Polish, Spanish, Swiss, Moroccan, Turkish, Chinese, Japanese (more common because of a founder effect), East Indian (potentially related to Japanese founder mutation) [@pmid:37578398], Korean, and Vietnamese populations [@genereviews:NBK1333].", "age_onset": "Typical: 20-49 [@pmid:11436124]; Range: 8 [@pmid:15851746] - 83 [@doi:10.17161/2tmg0f25].", @@ -283,7 +283,7 @@ "inheritance": ["XR"], "association_type": ["Mendelian"], "disease_description": "Developmental and epileptic encephalopathy-1 (DEE1) is a severe form of epilepsy characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, characterized by high-voltage bursts alternating with almost flat suppression phases [@omim:308350].", - "hpo_terms": ["HP:0000054 Micropenis", "HP:0000252 Microcephaly", "HP:0000568 Microphthalmia", "HP:0000817 Reduced eye contact", "HP:0001249 Intellectual disability", "HP:0001263 Global developmental delay", "HP:0001266 Choreoathetosis", "HP:0001276 Hypertonia", "HP:0001285 Spastic tetraparesis", "HP:0001332 Dystonia", "HP:0001347 Hyperreflexia", "HP:0001357 Plagiocephaly", "HP:0001510 Growth delay", "HP:0002015 Dysphagia", "HP:0002094 Dyspnea", "HP:0002119 Ventriculomegaly", "HP:0002123 Generalized myoclonic seizure", "HP:0002188 Delayed CNS myelination", "HP:0002283 Global brain atrophy", "HP:0002421 Poor head control", "HP:0002521 Hypsarrhythmia", "HP:0007256 Abnormal pyramidal sign", "HP:0007359 Focal-onset seizure", "HP:0008936 Axial hypotonia", "HP:0010851 EEG with burst suppression", "HP:0011153 Focal motor seizure", "HP:0011344 Severe global developmental delay", "HP:0012469 Infantile spasms", "HP:0025357 Erratic myoclonus", "HP:0032792 Tonic seizure", "HP:0100660 Dyskinesia", "HP:0200134 Epileptic encephalopathy"], + "hpo_terms": ["HP:0000020 Urinary incontinence", "HP:0000054 Micropenis", "HP:0000252 Microcephaly", "HP:0000407 Sensorineural hearing impairment", "HP:0000568 Microphthalmia", "HP:0000629 Periorbital fullness", "HP:0000637 Long palpebral fissure", "HP:0000729 Autistic behavior", "HP:0000752 Hyperactivity", "HP:0000817 Reduced eye contact", "HP:0001249 Intellectual disability", "HP:0001250 Seizure", "HP:0001252 Hypotonia", "HP:0001254 Lethargy", "HP:0001257 Spasticity", "HP:0001263 Global developmental delay", "HP:0001266 Choreoathetosis", "HP:0001272 Cerebellar atrophy", "HP:0001276 Hypertonia", "HP:0001285 Spastic tetraparesis", "HP:0001302 Pachygyria", "HP:0001332 Dystonia", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001347 Hyperreflexia", "HP:0001357 Plagiocephaly", "HP:0001510 Growth delay", "HP:0001763 Pes planus", "HP:0002015 Dysphagia", "HP:0002033 Poor suck", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002079 Hypoplasia of the corpus callosum", "HP:0002094 Dyspnea", "HP:0002119 Ventriculomegaly", "HP:0002121 Generalized non-motor (absence) seizure", "HP:0002123 Generalized myoclonic seizure", "HP:0002131 Episodic ataxia", "HP:0002188 Delayed CNS myelination", "HP:0002205 Recurrent respiratory infections", "HP:0002283 Global brain atrophy", "HP:0002307 Drooling", "HP:0002353 EEG abnormality", "HP:0002360 Sleep disturbance", "HP:0002373 Febrile seizure (within the age range of 3 months to 6 years)", "HP:0002376 Developmental regression", "HP:0002421 Poor head control", "HP:0002506 Diffuse cerebral atrophy", "HP:0002521 Hypsarrhythmia", "HP:0003487 Babinski sign", "HP:0007204 Diffuse white matter abnormalities", "HP:0007256 Abnormal pyramidal sign", "HP:0007359 Focal-onset seizure", "HP:0008733 Dysplastic testis", "HP:0008936 Axial hypotonia", "HP:0008947 Floppy infant", "HP:0010818 Generalized tonic seizure", "HP:0010819 Atonic seizure", "HP:0010850 EEG with spike-wave complexes", "HP:0010851 EEG with burst suppression", "HP:0010864 Severe intellectual disability", "HP:0011153 Focal motor seizure", "HP:0011167 Focal tonic seizure", "HP:0011169 Generalized clonic seizure", "HP:0011190 Uni- and bilateral multifocal epileptiform discharges", "HP:0011344 Severe global developmental delay", "HP:0011968 Feeding difficulties", "HP:0012448 Delayed myelination", "HP:0012469 Infantile spasms", "HP:0025357 Erratic myoclonus", "HP:0032792 Tonic seizure", "HP:0100660 Dyskinesia", "HP:0100716 Self-injurious behavior", "HP:0200134 Epileptic encephalopathy"], "prevalence": null, "prevalence_details": "Found in individuals of multiple ethnicities, including European and Asian ancestry [@pmid:12874418].", "age_onset": "Typical: 0 [@pmid:21204215; @pmid:9307258]; Range: 0-4; 70% of cases involve infantile spasms, leading to seizures by 3 or 4 years [@pmid:19587282].", @@ -1040,7 +1040,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian", "Risk"], "disease_description": "Pure frontotemporal dementia, pure amyotrophic lateral sclerosis or combination of the two [@pmid:39349043]. Nominal associations with risk of Parkinson's have also been reported [@pmid:41074692]. May present as non-Huntington chorea in rare cases [@pmid:41957010].", - "hpo_terms": ["HP:0000217 Xerostomia", "HP:0000605 Supranuclear gaze palsy", "HP:0000708 Atypical behavior", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000726 Dementia", "HP:0000738 Hallucinations", "HP:0000739 Anxiety", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001300 Parkinsonism", "HP:0001308 Tongue fasciculations", "HP:0001324 Muscle weakness", "HP:0001347 Hyperreflexia", "HP:0001618 Dysphonia", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002059 Cerebral atrophy", "HP:0002094 Dyspnea", "HP:0002145 Frontotemporal dementia", "HP:0002171 Gliosis", "HP:0002180 Neurodegeneration", "HP:0002186 Apraxia", "HP:0002273 Tetraparesis", "HP:0002307 Drooling", "HP:0002313 Spastic paraparesis", "HP:0002360 Sleep disturbance", "HP:0002366 Abnormal lower motor neuron morphology", "HP:0002380 Fasciculations", "HP:0002385 Paraparesis", "HP:0002442 Dyscalculia", "HP:0002463 Language impairment", "HP:0002529 Neuronal loss in central nervous system", "HP:0002878 Respiratory failure", "HP:0003202 Skeletal muscle atrophy", "HP:0003324 Generalized muscle weakness", "HP:0003376 Steppage gait", "HP:0003394 Muscle spasm", "HP:0003470 Paralysis", "HP:0003484 Upper limb muscle weakness", "HP:0003487 Babinski sign", "HP:0003693 Distal amyotrophy", "HP:0004326 Cachexia", "HP:0007308 Extrapyramidal dyskinesia", "HP:0007340 Lower limb muscle weakness", "HP:0007354 Amyotrophic lateral sclerosis", "HP:0007373 Motor neuron atrophy", "HP:0008955 Progressive distal muscular atrophy", "HP:0009027 Foot dorsiflexor weakness", "HP:0012378 Fatigue", "HP:0012473 Tongue atrophy", "HP:0012531 Pain", "HP:0012764 Orthopnea", "HP:0025425 Laryngospasm", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030195 Fatigable weakness of swallowing muscles", "HP:0030196 Fatigable weakness of respiratory muscles", "HP:0030878 Abnormality on pulmonary function testing", "HP:0031993 Hoffmann sign", "HP:0033683 Jaw hyperreflexia", "HP:0100543 Cognitive impairment"], + "hpo_terms": ["HP:0000605 Supranuclear gaze palsy", "HP:0000708 Atypical behavior", "HP:0000716 Depression", "HP:0000726 Dementia", "HP:0000734 Disinhibition", "HP:0000738 Hallucinations", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0001260 Dysarthria", "HP:0001265 Hyporeflexia", "HP:0001283 Bulbar palsy", "HP:0001300 Parkinsonism", "HP:0001324 Muscle weakness", "HP:0002015 Dysphagia", "HP:0002059 Cerebral atrophy", "HP:0002071 Abnormality of extrapyramidal motor function", "HP:0002073 Progressive cerebellar ataxia", "HP:0002127 Abnormal upper motor neuron morphology", "HP:0002145 Frontotemporal dementia", "HP:0002171 Gliosis", "HP:0002186 Apraxia", "HP:0002273 Tetraparesis", "HP:0002283 Global brain atrophy", "HP:0002300 Mutism", "HP:0002314 Degeneration of the lateral corticospinal tracts", "HP:0002366 Abnormal lower motor neuron morphology", "HP:0002380 Fasciculations", "HP:0002385 Paraparesis", "HP:0002442 Dyscalculia", "HP:0002460 Distal muscle weakness", "HP:0002529 Neuronal loss in central nervous system", "HP:0003202 Skeletal muscle atrophy", "HP:0003487 Babinski sign", "HP:0003700 Generalized amyotrophy", "HP:0003701 Proximal muscle weakness", "HP:0007190 Neuronal loss in the cerebral cortex", "HP:0007308 Extrapyramidal dyskinesia", "HP:0007354 Amyotrophic lateral sclerosis", "HP:0008322 Abnormal mitochondrial morphology", "HP:0008619 Bilateral sensorineural hearing impairment", "HP:0010549 Weakness due to upper motor neuron dysfunction", "HP:0030223 Perseverative thought"], "prevalence": null, "prevalence_details": "The expansion of a hexanucleotide repeat GGGGCC in C9orf72 is the most common known cause of ALS accounting for ~ 40% familial cases and ~ 7% sporadic cases in the European population; overall ALS incidence is 1-2/100,000 person-years, point prevalence is 3-5/100,000 (Europe/US); lifetime risk is 1 in 300 [@pmid:31315673]. Relatives of patients with C9orf72-ALS appear at an increased risk of disease regardless of carrier status [@pmid:38149039; @pmid:39315390]. C9orf72-FTD is estimated to be 0.04-134:100,000 [@genereviews:NBK268647], and by our estimates 0.65-1.56/100,000 for C9orf72-ALS. The expansion has been found across ethnicities/ancestries, with population-dependent prevalence, highest in those with northern European ancestry [@genereviews:NBK268647].", "age_onset": "Typical: 50-64; Range: 20-91 [@genereviews:NBK268647].", @@ -1241,7 +1241,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts [@omim:609812]. Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions [@genereviews:NBK500456]. In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype [@pmid:34850019]. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED) [@pmid:18544793].", - "hpo_terms": ["HP:0001738 Exocrine pancreatic insufficiency", "HP:0002027 Abdominal pain", "HP:0003074 Hyperglycemia", "HP:0004904 Maturity-onset diabetes of the young", "HP:0040217 Elevated hemoglobin A1c"], + "hpo_terms": ["HP:0000112 Nephropathy", "HP:0000488 Retinopathy", "HP:0000825 Hyperinsulinemic hypoglycemia", "HP:0000831 Insulin-resistant diabetes mellitus", "HP:0001511 Intrauterine growth retardation", "HP:0001520 Large for gestational age", "HP:0001738 Exocrine pancreatic insufficiency", "HP:0001952 Glucose intolerance", "HP:0001998 Neonatal hypoglycemia", "HP:0002027 Abdominal pain", "HP:0003074 Hyperglycemia", "HP:0003076 Glycosuria", "HP:0004904 Maturity-onset diabetes of the young", "HP:0004924 Abnormal oral glucose tolerance", "HP:0008255 Transient neonatal diabetes mellitus", "HP:0025502 Overweight", "HP:0030794 Abnormal circulating C-peptide concentration", "HP:0040214 Abnormal circulating insulin concentration", "HP:0040216 Hypoinsulinemia", "HP:0040217 Elevated hemoglobin A1c"], "prevalence": null, "prevalence_details": "Found in individuals of Danish and Norwegian ancestry [@pmid:16369531; @pmid:19760265].", "age_onset": "11-17 [@pmid:19760265]", @@ -1395,7 +1395,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Pseudoachondroplasia is characterized by severe growth deficiency and deformations such as bow legs and hyperlordosis. Multiple epiphyseal dysplasia type 1 (MED 1) is a form of multiple epiphyseal dysplasia that is characterized by normal or mild short stature, pain in the hips and/or knees, progressive deformity of extremities and early-onset osteoarthrosis. Specific features of MED 1 include a more pronounced involvement of hip joints and gait abnormality and a shorter adult height. MED1 is allelic to pseudoachondroplasia with which it shares clinical and radiological features. The disease follows an autosomal dominant mode of transmission [@mondo:0008322; @mondo:0007561].", - "hpo_terms": ["HP:0000763 Sensory neuropathy", "HP:0000926 Platyspondyly", "HP:0001156 Brachydactyly", "HP:0001249 Intellectual disability", "HP:0001288 Gait disturbance", "HP:0001376 Limitation of joint mobility", "HP:0001377 Limited elbow extension", "HP:0001382 Joint hypermobility", "HP:0001385 Hip dysplasia", "HP:0001387 Joint stiffness", "HP:0001498 Carpal bone hypoplasia", "HP:0001763 Pes planus", "HP:0002341 Cervical cord compression", "HP:0002515 Waddling gait", "HP:0002650 Scoliosis", "HP:0002656 Epiphyseal dysplasia", "HP:0002663 Delayed epiphyseal ossification", "HP:0002758 Osteoarthritis", "HP:0002761 Generalized joint hypermobility", "HP:0002808 Kyphosis", "HP:0002812 Coxa vara", "HP:0002816 Genu recurvatum", "HP:0002829 Arthralgia", "HP:0002834 Flared femoral metaphysis", "HP:0002857 Genu valgum", "HP:0002938 Lumbar hyperlordosis", "HP:0002970 Genu varum", "HP:0003015 Flared metaphysis", "HP:0003016 Metaphyseal widening", "HP:0003025 Metaphyseal irregularity", "HP:0003026 Short long bone", "HP:0003049 Ulnar deviation of the wrist", "HP:0003090 Hypoplasia of the capital femoral epiphysis", "HP:0003093 Limited hip extension", "HP:0003170 Abnormal acetabulum morphology", "HP:0003180 Flat acetabular roof", "HP:0003300 Ovoid vertebral bodies", "HP:0003301 Irregular vertebral endplates", "HP:0003311 Hypoplasia of the odontoid process", "HP:0003312 Abnormal vertebral body morphology", "HP:0003365 Arthralgia of the hip", "HP:0003414 Atlantoaxial dislocation", "HP:0003498 Disproportionate short stature", "HP:0003502 Mild short stature", "HP:0003510 Severe short stature", "HP:0003756 Skeletal myopathy", "HP:0004019 Radial metaphyseal irregularity", "HP:0004042 Ulnar metaphyseal irregularity", "HP:0004236 Irregular carpal bones", "HP:0004568 Beaking of vertebral bodies", "HP:0005063 Fragmented, irregular epiphyses", "HP:0005720 Shortening of all metacarpals", "HP:0005743 Avascular necrosis of the capital femoral epiphysis", "HP:0006094 Finger joint hypermobility", "HP:0006149 Increased laxity of fingers", "HP:0006429 Broad femoral neck", "HP:0006460 Ankle hypermobility", "HP:0006467 Limited shoulder movement", "HP:0006499 Abnormal femoral epiphysis morphology", "HP:0008800 Limited hip movement", "HP:0008807 Acetabular dysplasia", "HP:0008833 Irregular acetabular roof", "HP:0008839 Hypoplastic pelvis", "HP:0008843 Hip osteoarthritis", "HP:0008873 Disproportionate short-limb short stature", "HP:0009107 Abnormal ossification involving the femoral head and neck", "HP:0009487 Ulnar deviation of the hand", "HP:0009803 Short phalanx of finger", "HP:0009826 Limb undergrowth", "HP:0009882 Short distal phalanx of finger", "HP:0010049 Short metacarpal", "HP:0010236 Small epiphyses of the phalanges of the hand", "HP:0010579 Cone-shaped epiphysis", "HP:0010582 Irregular epiphyses", "HP:0010585 Small epiphyses", "HP:0010646 Cervical spine instability", "HP:0011405 Childhood onset short-limb short stature", "HP:0012307 Spatulate ribs", "HP:0020152 Distal joint hypermobility", "HP:0030839 Knee pain", "HP:0030840 Ankle pain", "HP:0030973 Postexertional symptom exacerbation", "HP:0045086 Knee joint hypermobility", "HP:0100168 Fragmented epiphyses", "HP:0100531 Wind-swept deformity of the knees", "HP:0100864 Short femoral neck"], + "hpo_terms": ["HP:0000763 Sensory neuropathy", "HP:0000926 Platyspondyly", "HP:0001156 Brachydactyly", "HP:0001249 Intellectual disability", "HP:0001288 Gait disturbance", "HP:0001376 Limitation of joint mobility", "HP:0001377 Limited elbow extension", "HP:0001382 Joint hypermobility", "HP:0001385 Hip dysplasia", "HP:0001387 Joint stiffness", "HP:0001498 Carpal bone hypoplasia", "HP:0001763 Pes planus", "HP:0002341 Cervical cord compression", "HP:0002515 Waddling gait", "HP:0002650 Scoliosis", "HP:0002656 Epiphyseal dysplasia", "HP:0002663 Delayed epiphyseal ossification", "HP:0002758 Osteoarthritis", "HP:0002761 Generalized joint hypermobility", "HP:0002808 Kyphosis", "HP:0002816 Genu recurvatum", "HP:0002829 Arthralgia", "HP:0002834 Flared femoral metaphysis", "HP:0002857 Genu valgum", "HP:0002938 Lumbar hyperlordosis", "HP:0002970 Genu varum", "HP:0003015 Flared metaphysis", "HP:0003016 Metaphyseal widening", "HP:0003025 Metaphyseal irregularity", "HP:0003026 Short long bone", "HP:0003049 Ulnar deviation of the wrist", "HP:0003090 Hypoplasia of the capital femoral epiphysis", "HP:0003093 Limited hip extension", "HP:0003170 Abnormal acetabulum morphology", "HP:0003180 Flat acetabular roof", "HP:0003300 Ovoid vertebral bodies", "HP:0003301 Irregular vertebral endplates", "HP:0003311 Hypoplasia of the odontoid process", "HP:0003312 Abnormal vertebral body morphology", "HP:0003365 Arthralgia of the hip", "HP:0003414 Atlantoaxial dislocation", "HP:0003498 Disproportionate short stature", "HP:0003502 Mild short stature", "HP:0003510 Severe short stature", "HP:0003756 Skeletal myopathy", "HP:0004019 Radial metaphyseal irregularity", "HP:0004042 Ulnar metaphyseal irregularity", "HP:0004236 Irregular carpal bones", "HP:0004568 Beaking of vertebral bodies", "HP:0005063 Fragmented, irregular epiphyses", "HP:0005720 Shortening of all metacarpals", "HP:0005743 Avascular necrosis of the capital femoral epiphysis", "HP:0006094 Finger joint hypermobility", "HP:0006149 Increased laxity of fingers", "HP:0006429 Broad femoral neck", "HP:0006460 Ankle hypermobility", "HP:0006467 Limited shoulder movement", "HP:0006499 Abnormal femoral epiphysis morphology", "HP:0008800 Limited hip movement", "HP:0008807 Acetabular dysplasia", "HP:0008833 Irregular acetabular roof", "HP:0008839 Hypoplastic pelvis", "HP:0008843 Hip osteoarthritis", "HP:0008873 Disproportionate short-limb short stature", "HP:0009107 Abnormal ossification involving the femoral head and neck", "HP:0009487 Ulnar deviation of the hand", "HP:0009803 Short phalanx of finger", "HP:0009826 Limb undergrowth", "HP:0009882 Short distal phalanx of finger", "HP:0010049 Short metacarpal", "HP:0010236 Small epiphyses of the phalanges of the hand", "HP:0010579 Cone-shaped epiphysis", "HP:0010582 Irregular epiphyses", "HP:0010585 Small epiphyses", "HP:0011405 Childhood onset short-limb short stature", "HP:0012307 Spatulate ribs", "HP:0020152 Distal joint hypermobility", "HP:0030839 Knee pain", "HP:0030840 Ankle pain", "HP:0030973 Postexertional symptom exacerbation", "HP:0045086 Knee joint hypermobility", "HP:0100168 Fragmented epiphyses", "HP:0100531 Wind-swept deformity of the knees", "HP:0100864 Short femoral neck"], "prevalence": null, "prevalence_details": "Specific contribution of COMP repeats to EDM1 is unknown (~300 COMP mutation variants for both phenotypes); likely 1:90,000 prevalence for COMP-PSACH that is repeat-specific. Found across ancestries/ethnicities [@genereviews:NBK1123; @genereviews:NBK1487].", "age_onset": "Typical: 0-2 (COMP-PSACH)/ 1-12 (EDM1); Range: 0 (PSACH) - 13 (EDM1). 3-13 specific to trinucleotide expansions (duplications) [@pmid:29530484], several contractions but unknown exact AoO [@genereviews:NBK1123; @genereviews:NBK1487].", @@ -1822,7 +1822,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Steinert disease, also known as myotonic dystrophy type 1, is a muscle disease characterized by myotonia and by multiorgan damage that combines various degrees of muscle weakness, arrhythmia and/or cardiac conduction disorders, cataract, endocrine damage, sleep disorders and baldness [@mondo:0008056]. It has also been linked to Autism and related traits, especially in individuals with earlier onset [@pmid:40259070; @pmid:29361396; @pmid:8810716; @pmid:27695335; @pmid:29871899; @pmid:37209486].", - "hpo_terms": ["HP:0000026 Male hypogonadism", "HP:0000029 Testicular atrophy", "HP:0000135 Hypogonadism", "HP:0000144 Decreased fertility", "HP:0000467 Neck muscle weakness", "HP:0000483 Astigmatism", "HP:0000518 Cataract", "HP:0000540 Hypermetropia", "HP:0000602 Ophthalmoplegia", "HP:0000708 Atypical behavior", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000717 Autism", "HP:0000718 Aggressive behavior", "HP:0000729 Autistic behavior", "HP:0000736 Short attention span", "HP:0000739 Anxiety", "HP:0000802 Impotence", "HP:0000815 Hypergonadotropic hypogonadism", "HP:0000819 Diabetes mellitus", "HP:0000824 Decreased response to growth hormone stimulation test", "HP:0000842 Hyperinsulinemia", "HP:0000855 Insulin resistance", "HP:0000867 Secondary hyperparathyroidism", "HP:0001081 Cholelithiasis", "HP:0001249 Intellectual disability", "HP:0001252 Hypotonia", "HP:0001256 Mild intellectual disability", "HP:0001260 Dysarthria", "HP:0001262 Excessive daytime somnolence", "HP:0001263 Global developmental delay", "HP:0001268 Mental deterioration", "HP:0001288 Gait disturbance", "HP:0001290 Generalized hypotonia", "HP:0001319 Neonatal hypotonia", "HP:0001324 Muscle weakness", "HP:0001328 Specific learning disability", "HP:0001349 Facial diplegia", "HP:0001488 Bilateral ptosis", "HP:0001558 Decreased fetal movement", "HP:0001561 Polyhydramnios", "HP:0001596 Alopecia", "HP:0001644 Dilated cardiomyopathy", "HP:0001762 Talipes equinovarus", "HP:0002014 Diarrhea", "HP:0002015 Dysphagia", "HP:0002019 Constipation", "HP:0002059 Cerebral atrophy", "HP:0002093 Respiratory insufficiency", "HP:0002098 Respiratory distress", "HP:0002120 Cerebral cortical atrophy", "HP:0002234 Early balding", "HP:0002292 Frontal balding", "HP:0002460 Distal muscle weakness", "HP:0002486 Myotonia", "HP:0002494 Abnormal rapid eye movement sleep", "HP:0002500 Abnormal cerebral white matter morphology", "HP:0002527 Falls", "HP:0002540 Inability to walk", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0002870 Obstructive sleep apnea", "HP:0002878 Respiratory failure", "HP:0002910 Elevated circulating hepatic transaminase concentration", "HP:0002926 Abnormality of thyroid physiology", "HP:0003003 Colon cancer", "HP:0003124 Hypercholesterolemia", "HP:0003202 Skeletal muscle atrophy", "HP:0003326 Myalgia", "HP:0003477 Peripheral axonal neuropathy", "HP:0003547 Shoulder girdle muscle weakness", "HP:0003693 Distal amyotrophy", "HP:0003701 Proximal muscle weakness", "HP:0003722 Neck flexor weakness", "HP:0003740 Myotonia with warm-up phenomenon", "HP:0003749 Pelvic girdle muscle weakness", "HP:0004389 Intestinal pseudo-obstruction", "HP:0004749 Atrial flutter", "HP:0004755 Supraventricular tachycardia", "HP:0004887 Respiratory failure requiring assisted ventilation", "HP:0005110 Atrial fibrillation", "HP:0006677 Prolonged QRS complex", "HP:0006889 Borderline intellectual disability", "HP:0007010 Poor fine motor coordination", "HP:0007663 Reduced visual acuity", "HP:0007787 Posterior subcapsular cataract", "HP:0007941 Limited extraocular movements", "HP:0008069 Neoplasm of the skin", "HP:0008770 Obsessive-compulsive trait", "HP:0008872 Feeding difficulties in infancy", "HP:0009027 Foot dorsiflexor weakness", "HP:0009113 Diaphragmatic weakness", "HP:0009830 Peripheral neuropathy", "HP:0010794 Impaired visuospatial constructive cognition", "HP:0010804 Tented upper lip vermilion", "HP:0010864 Severe intellectual disability", "HP:0010952 Mild fetal ventriculomegaly", "HP:0011470 Nasogastric tube feeding in infancy", "HP:0011705 First degree atrioventricular block", "HP:0011999 Paranoia", "HP:0012054 Choroidal melanoma", "HP:0012114 Endometrial carcinoma", "HP:0012248 Prolonged PR interval", "HP:0012378 Fatigue", "HP:0012899 Handgrip myotonia", "HP:0012901 Myotonia of the jaw", "HP:0012903 Myotonia of the upper limb", "HP:0025169 Left ventricular systolic dysfunction", "HP:0025318 Ovarian carcinoma", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0030692 Brain neoplasm", "HP:0031466 Impairment in personality functioning", "HP:0031546 Cardiac conduction abnormality", "HP:0040171 Decreased serum testosterone concentration", "HP:0040173 Abnormality of the tongue muscle", "HP:0040198 Non-medullary thyroid carcinoma", "HP:0100284 EMG: myotonic discharges", "HP:0100543 Cognitive impairment", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0410011 Abnormality of masticatory muscle"], + "hpo_terms": ["HP:0000026 Male hypogonadism", "HP:0000029 Testicular atrophy", "HP:0000135 Hypogonadism", "HP:0000144 Decreased fertility", "HP:0000467 Neck muscle weakness", "HP:0000483 Astigmatism", "HP:0000518 Cataract", "HP:0000540 Hypermetropia", "HP:0000602 Ophthalmoplegia", "HP:0000708 Atypical behavior", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000729 Autistic behavior", "HP:0000736 Short attention span", "HP:0000739 Anxiety", "HP:0000802 Impotence", "HP:0000815 Hypergonadotropic hypogonadism", "HP:0000819 Diabetes mellitus", "HP:0000842 Hyperinsulinemia", "HP:0000855 Insulin resistance", "HP:0000867 Secondary hyperparathyroidism", "HP:0001081 Cholelithiasis", "HP:0001249 Intellectual disability", "HP:0001252 Hypotonia", "HP:0001256 Mild intellectual disability", "HP:0001260 Dysarthria", "HP:0001262 Excessive daytime somnolence", "HP:0001263 Global developmental delay", "HP:0001268 Mental deterioration", "HP:0001288 Gait disturbance", "HP:0001290 Generalized hypotonia", "HP:0001319 Neonatal hypotonia", "HP:0001324 Muscle weakness", "HP:0001328 Specific learning disability", "HP:0001349 Facial diplegia", "HP:0001488 Bilateral ptosis", "HP:0001558 Decreased fetal movement", "HP:0001561 Polyhydramnios", "HP:0001596 Alopecia", "HP:0001762 Talipes equinovarus", "HP:0002014 Diarrhea", "HP:0002015 Dysphagia", "HP:0002019 Constipation", "HP:0002059 Cerebral atrophy", "HP:0002093 Respiratory insufficiency", "HP:0002098 Respiratory distress", "HP:0002120 Cerebral cortical atrophy", "HP:0002234 Early balding", "HP:0002292 Frontal balding", "HP:0002460 Distal muscle weakness", "HP:0002486 Myotonia", "HP:0002494 Abnormal rapid eye movement sleep", "HP:0002500 Abnormal cerebral white matter morphology", "HP:0002527 Falls", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0002870 Obstructive sleep apnea", "HP:0002878 Respiratory failure", "HP:0002910 Elevated circulating hepatic transaminase concentration", "HP:0002926 Abnormality of thyroid physiology", "HP:0003124 Hypercholesterolemia", "HP:0003202 Skeletal muscle atrophy", "HP:0003326 Myalgia", "HP:0003693 Distal amyotrophy", "HP:0003701 Proximal muscle weakness", "HP:0003722 Neck flexor weakness", "HP:0003740 Myotonia with warm-up phenomenon", "HP:0004389 Intestinal pseudo-obstruction", "HP:0004749 Atrial flutter", "HP:0004755 Supraventricular tachycardia", "HP:0004887 Respiratory failure requiring assisted ventilation", "HP:0005110 Atrial fibrillation", "HP:0006677 Prolonged QRS complex", "HP:0006889 Borderline intellectual disability", "HP:0007010 Poor fine motor coordination", "HP:0007663 Reduced visual acuity", "HP:0007787 Posterior subcapsular cataract", "HP:0007941 Limited extraocular movements", "HP:0008770 Obsessive-compulsive trait", "HP:0008872 Feeding difficulties in infancy", "HP:0009027 Foot dorsiflexor weakness", "HP:0009113 Diaphragmatic weakness", "HP:0009830 Peripheral neuropathy", "HP:0010794 Impaired visuospatial constructive cognition", "HP:0010804 Tented upper lip vermilion", "HP:0010864 Severe intellectual disability", "HP:0010952 Mild fetal ventriculomegaly", "HP:0011470 Nasogastric tube feeding in infancy", "HP:0011705 First degree atrioventricular block", "HP:0011999 Paranoia", "HP:0012248 Prolonged PR interval", "HP:0012378 Fatigue", "HP:0012899 Handgrip myotonia", "HP:0012901 Myotonia of the jaw", "HP:0012903 Myotonia of the upper limb", "HP:0025169 Left ventricular systolic dysfunction", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031466 Impairment in personality functioning", "HP:0031546 Cardiac conduction abnormality", "HP:0040171 Decreased serum testosterone concentration", "HP:0040173 Abnormality of the tongue muscle", "HP:0100284 EMG: myotonic discharges", "HP:0100543 Cognitive impairment", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0410011 Abnormality of masticatory muscle"], "prevalence": "9.27/100000", "prevalence_details": "5-20/100,000 [@genereviews:NBK1165]. 0.5-18.1/100,000 [@pmid:29100084]; 6.5/100,000 [@pmid:31159885]. 9.27 cases (95% CI: 4.73-15.21) per 100,000, ranging from 0.37 to 36.29 cases per 100,000 [@pmid:35483324]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1165].", "age_onset": "Typical: 10-30 [@genereviews:NBK1165]; Range: 0-74 [@pmid:38454488].", @@ -2023,7 +2023,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "This is a newly proposed locus for OPDM, it does not have a type number yet and has not been validated. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0008997 Proximal upper limb muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0010550 Paraplegia", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle", "HP:3000010 Abnormality of orbicularis oris muscle"], + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle"], "prevalence": null, "prevalence_details": "Found in two siblings in a UDN family [@pmid:38297326; @pmid:40357124].", "age_onset": "49-51 based on two siblings [@pmid:39868092].", @@ -2291,7 +2291,7 @@ "inheritance": ["AR"], "association_type": ["Mendelian"], "disease_description": "Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty [@omim:229300].", - "hpo_terms": ["HP:0000012 Urinary urgency", "HP:0000365 Hearing impairment", "HP:0000570 Abnormal saccadic eye movements", "HP:0000639 Nystagmus", "HP:0000648 Optic atrophy", "HP:0000716 Depression", "HP:0000739 Anxiety", "HP:0000819 Diabetes mellitus", "HP:0001063 Acrocyanosis", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001272 Cerebellar atrophy", "HP:0001310 Dysmetria", "HP:0001324 Muscle weakness", "HP:0001332 Dystonia", "HP:0001618 Dysphonia", "HP:0001638 Cardiomyopathy", "HP:0001760 Abnormal foot morphology", "HP:0001761 Pes cavus", "HP:0001762 Talipes equinovarus", "HP:0002015 Dysphagia", "HP:0002037 Inflammation of the large intestine", "HP:0002066 Gait ataxia", "HP:0002070 Limb ataxia", "HP:0002072 Chorea", "HP:0002075 Dysdiadochokinesis", "HP:0002080 Intention tremor", "HP:0002141 Gait imbalance", "HP:0002270 Abnormality of the autonomic nervous system", "HP:0002312 Clumsiness", "HP:0002495 Impaired vibratory sensation", "HP:0002522 Areflexia of lower limbs", "HP:0002527 Falls", "HP:0002540 Inability to walk", "HP:0002546 Incomprehensible speech", "HP:0002650 Scoliosis", "HP:0002839 Urinary bladder sphincter dysfunction", "HP:0003115 Abnormal EKG", "HP:0003390 Sensory axonal neuropathy", "HP:0003394 Muscle spasm", "HP:0003431 Decreased motor nerve conduction velocity", "HP:0003487 Babinski sign", "HP:0004349 Reduced bone mineral density", "HP:0007010 Poor fine motor coordination", "HP:0007663 Reduced visual acuity", "HP:0009130 Hand muscle atrophy", "HP:0010535 Sleep apnea", "HP:0010831 Impaired proprioception", "HP:0010873 Cervical spinal cord atrophy", "HP:0012079 Abnormality of central motor conduction", "HP:0012452 Restless legs", "HP:0025402 Square-wave jerks", "HP:0030183 Impaired visually enhanced vestibulo-ocular reflex"], + "hpo_terms": ["HP:0000012 Urinary urgency", "HP:0000365 Hearing impairment", "HP:0000505 Visual impairment", "HP:0000570 Abnormal saccadic eye movements", "HP:0000639 Nystagmus", "HP:0000648 Optic atrophy", "HP:0000649 Abnormality of visual evoked potentials", "HP:0000716 Depression", "HP:0000739 Anxiety", "HP:0000763 Sensory neuropathy", "HP:0000819 Diabetes mellitus", "HP:0001063 Acrocyanosis", "HP:0001123 Visual field defect", "HP:0001251 Ataxia", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001272 Cerebellar atrophy", "HP:0001310 Dysmetria", "HP:0001324 Muscle weakness", "HP:0001332 Dystonia", "HP:0001618 Dysphonia", "HP:0001626 Abnormality of the cardiovascular system", "HP:0001635 Congestive heart failure", "HP:0001638 Cardiomyopathy", "HP:0001639 Hypertrophic cardiomyopathy", "HP:0001760 Abnormal foot morphology", "HP:0001761 Pes cavus", "HP:0001762 Talipes equinovarus", "HP:0002015 Dysphagia", "HP:0002037 Inflammation of the large intestine", "HP:0002066 Gait ataxia", "HP:0002070 Limb ataxia", "HP:0002075 Dysdiadochokinesis", "HP:0002080 Intention tremor", "HP:0002141 Gait imbalance", "HP:0002270 Abnormality of the autonomic nervous system", "HP:0002312 Clumsiness", "HP:0002495 Impaired vibratory sensation", "HP:0002522 Areflexia of lower limbs", "HP:0002527 Falls", "HP:0002540 Inability to walk", "HP:0002546 Incomprehensible speech", "HP:0002650 Scoliosis", "HP:0002839 Urinary bladder sphincter dysfunction", "HP:0003115 Abnormal EKG", "HP:0003209 Decreased pyruvate carboxylase activity", "HP:0003232 Mitochondrial malic enzyme reduced", "HP:0003390 Sensory axonal neuropathy", "HP:0003394 Muscle spasm", "HP:0003431 Decreased motor nerve conduction velocity", "HP:0003448 Decreased sensory nerve conduction velocity", "HP:0003487 Babinski sign", "HP:0004349 Reduced bone mineral density", "HP:0007010 Poor fine motor coordination", "HP:0007078 Decreased amplitude of sensory action potentials", "HP:0007663 Reduced visual acuity", "HP:0009130 Hand muscle atrophy", "HP:0010535 Sleep apnea", "HP:0010831 Impaired proprioception", "HP:0010873 Cervical spinal cord atrophy", "HP:0012079 Abnormality of central motor conduction", "HP:0012452 Restless legs", "HP:0025402 Square-wave jerks", "HP:0030183 Impaired visually enhanced vestibulo-ocular reflex"], "prevalence": "1/50000", "prevalence_details": "1/50,000 [@omim:229300; @pmid:29100084]: Known carrier frequency 1000/100,000; observed 421/100,000. Most common inherited ataxia in Europe, the Middle East, India, and North Africa; not documented in Southeast Asia, in sub-Saharan Africa, or among Native Americans [@genereviews:NBK1281].", "age_onset": "Typical: 10-15; Range: 2-80 [@genereviews:NBK1281].", @@ -2435,7 +2435,7 @@ "inheritance": ["AR"], "association_type": ["Mendelian"], "disease_description": "Glutaminase deficiency is characterized by refractory seizures, respiratory failure, brain abnormalities and death in the neonatal period, though milder cases with spastic ataxia-dysarthria have also been reported. This condition is caused by mutations in the glutaminase (GLS) gene [@mondo:0600001].", - "hpo_terms": null, + "hpo_terms": ["HP:0000750 Delayed speech and language development", "HP:0001263 Global developmental delay", "HP:0001272 Cerebellar atrophy", "HP:0002073 Progressive cerebellar ataxia", "HP:0002194 Delayed gross motor development", "HP:0002373 Febrile seizure (within the age range of 3 months to 6 years)", "HP:0003217 Hyperglutaminemia"], "prevalence": null, "prevalence_details": "As of 2019, only 7 cases total of GLS deficiency, including non-repeat. Identified unrelated patients have been Canadian [@pmid:30970188], Kurdish (Turkey) [@pmid:35913761], and US-American (Northern European/Native American descent) [@pmid:35913761].", "age_onset": "Early childhood (2-4) [@pmid:30970188; @pmid:35913761].", @@ -2842,7 +2842,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian", "Risk"], "disease_description": "Huntington disease (HD) is a rare neurodegenerative disorder of the central nervous system characterized by unwanted choreatic movements, behavioral and psychiatric disturbances and dementia [@mondo:0007739].", - "hpo_terms": ["HP:0000496 Abnormality of eye movement", "HP:0000657 Oculomotor apraxia", "HP:0000713 Agitation", "HP:0000716 Depression", "HP:0000718 Aggressive behavior", "HP:0000722 Compulsive behaviors", "HP:0000726 Dementia", "HP:0000734 Disinhibition", "HP:0000737 Irritability", "HP:0000738 Hallucinations", "HP:0000739 Anxiety", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0000751 Personality changes", "HP:0001250 Seizure", "HP:0001262 Excessive daytime somnolence", "HP:0001268 Mental deterioration", "HP:0001272 Cerebellar atrophy", "HP:0001288 Gait disturbance", "HP:0001332 Dystonia", "HP:0001336 Myoclonus", "HP:0001347 Hyperreflexia", "HP:0001824 Weight loss", "HP:0002059 Cerebral atrophy", "HP:0002063 Rigidity", "HP:0002066 Gait ataxia", "HP:0002067 Bradykinesia", "HP:0002072 Chorea", "HP:0002141 Gait imbalance", "HP:0002169 Clonus", "HP:0002171 Gliosis", "HP:0002300 Mutism", "HP:0002312 Clumsiness", "HP:0002340 Caudate atrophy", "HP:0002354 Memory impairment", "HP:0002375 Hypokinesia", "HP:0002500 Abnormal cerebral white matter morphology", "HP:0002529 Neuronal loss in central nervous system", "HP:0002540 Inability to walk", "HP:0002591 Polyphagia", "HP:0003107 Abnormal circulating cholesterol concentration", "HP:0003324 Generalized muscle weakness", "HP:0003487 Babinski sign", "HP:0004305 Involuntary movements", "HP:0004408 Abnormality of the sense of smell", "HP:0007010 Poor fine motor coordination", "HP:0009088 Speech articulation difficulties", "HP:0010794 Impaired visuospatial constructive cognition", "HP:0025401 Staring gaze", "HP:0030842 Choking episodes", "HP:0030955 Addictive alcohol use", "HP:0031473 Anger", "HP:0031589 Suicidal ideation", "HP:0031843 Abnormally slow thought process", "HP:0031845 Abnormal libido", "HP:0040140 Degeneration of the striatum", "HP:0045082 Decreased body mass index", "HP:0100785 Insomnia", "HP:0200136 Oral-pharyngeal dysphagia"], + "hpo_terms": ["HP:0000496 Abnormality of eye movement", "HP:0000713 Agitation", "HP:0000716 Depression", "HP:0000718 Aggressive behavior", "HP:0000722 Compulsive behaviors", "HP:0000726 Dementia", "HP:0000734 Disinhibition", "HP:0000737 Irritability", "HP:0000738 Hallucinations", "HP:0000739 Anxiety", "HP:0000741 Apathy", "HP:0000746 Delusion", "HP:0000751 Personality changes", "HP:0001250 Seizure", "HP:0001262 Excessive daytime somnolence", "HP:0001268 Mental deterioration", "HP:0001272 Cerebellar atrophy", "HP:0001288 Gait disturbance", "HP:0001332 Dystonia", "HP:0001336 Myoclonus", "HP:0001347 Hyperreflexia", "HP:0001824 Weight loss", "HP:0002059 Cerebral atrophy", "HP:0002063 Rigidity", "HP:0002066 Gait ataxia", "HP:0002067 Bradykinesia", "HP:0002072 Chorea", "HP:0002141 Gait imbalance", "HP:0002169 Clonus", "HP:0002171 Gliosis", "HP:0002300 Mutism", "HP:0002312 Clumsiness", "HP:0002340 Caudate atrophy", "HP:0002354 Memory impairment", "HP:0002375 Hypokinesia", "HP:0002500 Abnormal cerebral white matter morphology", "HP:0002529 Neuronal loss in central nervous system", "HP:0002540 Inability to walk", "HP:0002591 Polyphagia", "HP:0003107 Abnormal circulating cholesterol concentration", "HP:0003324 Generalized muscle weakness", "HP:0003487 Babinski sign", "HP:0004305 Involuntary movements", "HP:0004408 Abnormality of the sense of smell", "HP:0007010 Poor fine motor coordination", "HP:0009088 Speech articulation difficulties", "HP:0010794 Impaired visuospatial constructive cognition", "HP:0025401 Staring gaze", "HP:0030842 Choking episodes", "HP:0030955 Addictive alcohol use", "HP:0031473 Anger", "HP:0031589 Suicidal ideation", "HP:0031843 Abnormally slow thought process", "HP:0031845 Abnormal libido", "HP:0040140 Degeneration of the striatum", "HP:0045082 Decreased body mass index", "HP:0100785 Insomnia", "HP:0200136 Oral-pharyngeal dysphagia"], "prevalence": "1/10000", "prevalence_details": "6.5-15/100,000 [@pmid:29100084]. 9.71-17:100,000 (European) vs. 0.1-2/100,000 (African), as many as 1 in 400 have reduced penetrance (0.2-2% for 36-38 CAG) HTT alleles [@genereviews:NBK1305]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1305].", "age_onset": "Typical: 35-44 [@genereviews:NBK1305]; Range: 1-85 [@pmid:39441074; @pmid:21171977].", @@ -2991,7 +2991,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Adult-onset ptosis, dysphagia [@pmid:39349043]; External ophthalmoplegia, facial weakness, pharyngeal, and distal limb weakness [@pmid:38876750]; May be slight male predominance [@pmid:34047774].", - "hpo_terms": ["HP:0000218 High palate", "HP:0000407 Sensorineural hearing impairment", "HP:0000508 Ptosis", "HP:0000544 External ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001251 Ataxia", "HP:0001260 Dysarthria", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001324 Muscle weakness", "HP:0001337 Tremor", "HP:0001488 Bilateral ptosis", "HP:0001611 Hypernasal speech", "HP:0001618 Dysphonia", "HP:0001639 Hypertrophic cardiomyopathy", "HP:0001644 Dilated cardiomyopathy", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002098 Respiratory distress", "HP:0002460 Distal muscle weakness", "HP:0002500 Abnormal cerebral white matter morphology", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0002835 Aspiration", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003394 Muscle spasm", "HP:0003458 EMG: myopathic abnormalities", "HP:0003557 Increased variability in muscle fiber diameter", "HP:0003693 Distal amyotrophy", "HP:0003701 Proximal muscle weakness", "HP:0003736 Autophagic vacuoles", "HP:0003805 Rimmed vacuoles", "HP:0004757 Paroxysmal atrial fibrillation", "HP:0008756 Bowing of the vocal cords", "HP:0009027 Foot dorsiflexor weakness", "HP:0010628 Facial palsy", "HP:0012416 Hypercapnia", "HP:0012444 Brain atrophy", "HP:0032341 Reduced forced vital capacity", "HP:0100284 EMG: myotonic discharges"], + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000407 Sensorineural hearing impairment", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000508 Ptosis", "HP:0000544 External ophthalmoplegia", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001251 Ataxia", "HP:0001260 Dysarthria", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001324 Muscle weakness", "HP:0001337 Tremor", "HP:0001488 Bilateral ptosis", "HP:0001604 Vocal cord paresis", "HP:0001611 Hypernasal speech", "HP:0001618 Dysphonia", "HP:0001639 Hypertrophic cardiomyopathy", "HP:0001644 Dilated cardiomyopathy", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002098 Respiratory distress", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002460 Distal muscle weakness", "HP:0002500 Abnormal cerebral white matter morphology", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0002835 Aspiration", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003394 Muscle spasm", "HP:0003458 EMG: myopathic abnormalities", "HP:0003557 Increased variability in muscle fiber diameter", "HP:0003693 Distal amyotrophy", "HP:0003701 Proximal muscle weakness", "HP:0003736 Autophagic vacuoles", "HP:0003805 Rimmed vacuoles", "HP:0004757 Paroxysmal atrial fibrillation", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0010628 Facial palsy", "HP:0012416 Hypercapnia", "HP:0012444 Brain atrophy", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0032341 Reduced forced vital capacity", "HP:0100284 EMG: myotonic discharges", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle"], "prevalence": null, "prevalence_details": "Population dependent; unknown percentage of LRP12 pathogenic variants. Typically East Asian ancestry [@pmid:38876750]; potentially most frequent cause of OPDM in Japan [@pmid:34047774].", "age_onset": "Typical: 31-51 [@pmid:34047774]; Range: 7-66 [@pmid:2124290].", @@ -3058,7 +3058,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical tremor with epilepsy [@pmid:39349043].", - "hpo_terms": ["HP:0001288 Gait disturbance", "HP:0001312 Giant somatosensory evoked potentials", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0007359 Focal-onset seizure", "HP:0010852 EEG with photoparoxysmal response"], + "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001288 Gait disturbance", "HP:0001312 Giant somatosensory evoked potentials", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002197 Generalized-onset seizure", "HP:0002315 Headache", "HP:0002353 EEG abnormality", "HP:0002378 Hand tremor", "HP:0007359 Focal-onset seizure", "HP:0010852 EEG with photoparoxysmal response", "HP:0100576 Amaurosis fugax"], "prevalence": null, "prevalence_details": "Overall FAME prevalence is < 1/35,000; MARCHF6-caused much smaller. Most cases have European ancestry [@pmid:38876750].", "age_onset": "Typical: 24-41 based on one 76 member pedigree [@pmid:19616813]; Range: 10 [@omim:613608] - 50 [@pmid:40788430].", @@ -3269,7 +3269,7 @@ "inheritance": ["AR"], "association_type": ["Mendelian"], "disease_description": "Patients with NAXE-related mitochondrial encephalopathy exhibit developmental delay, cognitive regression, altered consciousness, abnormalities in eye movement (including nystagmus), muscle weakness, respiratory failure, seizure, ataxia, and gait disturbance at the age of 1 to 2 years. The disease is characterized by fluctuating symptoms over time, often exacerbated by febrile illness; it is progressive and fatal in the long term [@pmid:39455596].", - "hpo_terms": ["HP:0000473 Torticollis", "HP:0000486 Strabismus", "HP:0000511 Vertical supranuclear gaze palsy", "HP:0000639 Nystagmus", "HP:0000711 Restlessness", "HP:0000737 Irritability", "HP:0001250 Seizure", "HP:0001251 Ataxia", "HP:0001252 Hypotonia", "HP:0001259 Coma", "HP:0001260 Dysarthria", "HP:0001263 Global developmental delay", "HP:0001298 Encephalopathy", "HP:0001337 Tremor", "HP:0002063 Rigidity", "HP:0002119 Ventriculomegaly", "HP:0002151 Increased circulating lactate concentration", "HP:0002181 Cerebral edema", "HP:0002196 Myelopathy", "HP:0002273 Tetraparesis", "HP:0002283 Global brain atrophy", "HP:0002318 Cervical myelopathy", "HP:0002352 Leukoencephalopathy", "HP:0002376 Developmental regression", "HP:0002490 Increased CSF lactate", "HP:0002878 Respiratory failure", "HP:0003128 Lactic acidosis", "HP:0006897 Abducens palsy", "HP:0011922 Abnormal activity of mitochondrial respiratory chain", "HP:0012378 Fatigue", "HP:0012444 Brain atrophy", "HP:0012706 Elevated brain choline level by MRS", "HP:0012762 Cerebral white matter atrophy", "HP:0030915 Cerebellar edema", "HP:0032794 Myoclonic seizure", "HP:0046507 Bradypnea", "HP:0200041 Skin erosion"], + "hpo_terms": ["HP:0000473 Torticollis", "HP:0000486 Strabismus", "HP:0000508 Ptosis", "HP:0000511 Vertical supranuclear gaze palsy", "HP:0000639 Nystagmus", "HP:0000708 Atypical behavior", "HP:0000711 Restlessness", "HP:0000737 Irritability", "HP:0000739 Anxiety", "HP:0001250 Seizure", "HP:0001251 Ataxia", "HP:0001252 Hypotonia", "HP:0001257 Spasticity", "HP:0001259 Coma", "HP:0001260 Dysarthria", "HP:0001263 Global developmental delay", "HP:0001272 Cerebellar atrophy", "HP:0001288 Gait disturbance", "HP:0001289 Confusion", "HP:0001298 Encephalopathy", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0002015 Dysphagia", "HP:0002063 Rigidity", "HP:0002119 Ventriculomegaly", "HP:0002151 Increased circulating lactate concentration", "HP:0002181 Cerebral edema", "HP:0002196 Myelopathy", "HP:0002273 Tetraparesis", "HP:0002283 Global brain atrophy", "HP:0002318 Cervical myelopathy", "HP:0002352 Leukoencephalopathy", "HP:0002376 Developmental regression", "HP:0002490 Increased CSF lactate", "HP:0002650 Scoliosis", "HP:0002878 Respiratory failure", "HP:0003128 Lactic acidosis", "HP:0006897 Abducens palsy", "HP:0011203 EEG with abnormally slow frequencies", "HP:0011355 Localized skin lesion", "HP:0011922 Abnormal activity of mitochondrial respiratory chain", "HP:0012378 Fatigue", "HP:0012444 Brain atrophy", "HP:0012706 Elevated brain choline level by MRS", "HP:0012762 Cerebral white matter atrophy", "HP:0030890 Hyperintensity of cerebral white matter on MRI", "HP:0030915 Cerebellar edema", "HP:0032794 Myoclonic seizure", "HP:0046507 Bradypnea", "HP:0200041 Skin erosion"], "prevalence": null, "prevalence_details": "Single proband found in Japanese cohort [@pmid:39455596].", "age_onset": "Single repeat expansion case had onset at 13 months, while NAXE-related mitochondrial encephalopathy more generally has predominately infantile onset, extending to 20y or older [@pmid:39455596].", @@ -3336,7 +3336,7 @@ "inheritance": ["AD"], "association_type": ["Modifier"], "disease_description": "Amyotrophic lateral sclerosis is a neurodegenerative disorder characterized by the death of motor neurons in the brain, brainstem, and spinal cord, resulting in fatal paralysis. ALS usually begins with asymmetric involvement of the muscles in middle adult life [@omim:105400].", - "hpo_terms": ["HP:0000217 Xerostomia", "HP:0000708 Atypical behavior", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000739 Anxiety", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001308 Tongue fasciculations", "HP:0001347 Hyperreflexia", "HP:0001618 Dysphonia", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002094 Dyspnea", "HP:0002145 Frontotemporal dementia", "HP:0002180 Neurodegeneration", "HP:0002307 Drooling", "HP:0002313 Spastic paraparesis", "HP:0002360 Sleep disturbance", "HP:0002380 Fasciculations", "HP:0002463 Language impairment", "HP:0002878 Respiratory failure", "HP:0003202 Skeletal muscle atrophy", "HP:0003324 Generalized muscle weakness", "HP:0003376 Steppage gait", "HP:0003394 Muscle spasm", "HP:0003470 Paralysis", "HP:0003484 Upper limb muscle weakness", "HP:0003487 Babinski sign", "HP:0003693 Distal amyotrophy", "HP:0004326 Cachexia", "HP:0007340 Lower limb muscle weakness", "HP:0007354 Amyotrophic lateral sclerosis", "HP:0007373 Motor neuron atrophy", "HP:0008955 Progressive distal muscular atrophy", "HP:0009027 Foot dorsiflexor weakness", "HP:0012378 Fatigue", "HP:0012473 Tongue atrophy", "HP:0012531 Pain", "HP:0012764 Orthopnea", "HP:0025425 Laryngospasm", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030195 Fatigable weakness of swallowing muscles", "HP:0030196 Fatigable weakness of respiratory muscles", "HP:0030878 Abnormality on pulmonary function testing", "HP:0031993 Hoffmann sign", "HP:0033683 Jaw hyperreflexia", "HP:0100543 Cognitive impairment"], + "hpo_terms": ["HP:0000217 Xerostomia", "HP:0000708 Atypical behavior", "HP:0000712 Emotional lability", "HP:0000716 Depression", "HP:0000739 Anxiety", "HP:0001257 Spasticity", "HP:0001260 Dysarthria", "HP:0001308 Tongue fasciculations", "HP:0001324 Muscle weakness", "HP:0001347 Hyperreflexia", "HP:0001618 Dysphonia", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002094 Dyspnea", "HP:0002145 Frontotemporal dementia", "HP:0002180 Neurodegeneration", "HP:0002307 Drooling", "HP:0002313 Spastic paraparesis", "HP:0002314 Degeneration of the lateral corticospinal tracts", "HP:0002360 Sleep disturbance", "HP:0002380 Fasciculations", "HP:0002398 Degeneration of anterior horn cells", "HP:0002463 Language impairment", "HP:0002878 Respiratory failure", "HP:0003202 Skeletal muscle atrophy", "HP:0003324 Generalized muscle weakness", "HP:0003376 Steppage gait", "HP:0003394 Muscle spasm", "HP:0003470 Paralysis", "HP:0003484 Upper limb muscle weakness", "HP:0003487 Babinski sign", "HP:0003693 Distal amyotrophy", "HP:0004326 Cachexia", "HP:0007024 Pseudobulbar paralysis", "HP:0007340 Lower limb muscle weakness", "HP:0007354 Amyotrophic lateral sclerosis", "HP:0007373 Motor neuron atrophy", "HP:0008955 Progressive distal muscular atrophy", "HP:0009027 Foot dorsiflexor weakness", "HP:0010535 Sleep apnea", "HP:0012378 Fatigue", "HP:0012473 Tongue atrophy", "HP:0012531 Pain", "HP:0012764 Orthopnea", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030195 Fatigable weakness of swallowing muscles", "HP:0030196 Fatigable weakness of respiratory muscles", "HP:0030878 Abnormality on pulmonary function testing", "HP:0031993 Hoffmann sign", "HP:0033683 Jaw hyperreflexia", "HP:0100543 Cognitive impairment"], "prevalence": null, "prevalence_details": "2.7-7.4/100,000 for all cases of ALS, NIPA1 + C9orf72 is 0.37% of ALS patients; frequency of NIPA1 expansion in controls is 3.74% [@pmid:31286297]. The NIPA1 expansion is associated with disease globally [@pmid:30342764], but likely unassociated in African probands [@pmid:34179866].", "age_onset": "Typical: 44-60 [@pmid:26777436]; Range: 25 [@pmid:22378146] - 77 [@pmid:26777436].", @@ -3403,7 +3403,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Spinocerebellar ataxia type 36 (SCA36) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1) characterized by gait and limb ataxia, lower limb spasticity, dysarthria, muscle fasciculations, tongue atrophy and hyperreflexia [@mondo:0013594]. Some affected individuals may develop hearing loss [@pmid:23140984; @omim:614153].", - "hpo_terms": ["HP:0000365 Hearing impairment", "HP:0000508 Ptosis", "HP:0000511 Vertical supranuclear gaze palsy", "HP:0000514 Slow saccadic eye movements", "HP:0000622 Blurred vision", "HP:0000639 Nystagmus", "HP:0000651 Diplopia", "HP:0001251 Ataxia", "HP:0001252 Hypotonia", "HP:0001260 Dysarthria", "HP:0001272 Cerebellar atrophy", "HP:0001276 Hypertonia", "HP:0001288 Gait disturbance", "HP:0001308 Tongue fasciculations", "HP:0001310 Dysmetria", "HP:0001324 Muscle weakness", "HP:0001347 Hyperreflexia", "HP:0002015 Dysphagia", "HP:0002066 Gait ataxia", "HP:0002070 Limb ataxia", "HP:0002076 Migraine", "HP:0002078 Truncal ataxia", "HP:0002080 Intention tremor", "HP:0002311 Incoordination", "HP:0002321 Vertigo", "HP:0002346 Head tremor", "HP:0002378 Hand tremor", "HP:0002380 Fasciculations", "HP:0002607 Bowel incontinence", "HP:0003202 Skeletal muscle atrophy", "HP:0003445 EMG: neuropathic changes", "HP:0003487 Babinski sign", "HP:0007001 Loss of Purkinje cells in the cerebellar vermis", "HP:0007018 Attention deficit hyperactivity disorder", "HP:0007772 Impaired smooth pursuit", "HP:0012473 Tongue atrophy", "HP:0045084 Limb myoclonus"], + "hpo_terms": ["HP:0000365 Hearing impairment", "HP:0000508 Ptosis", "HP:0000511 Vertical supranuclear gaze palsy", "HP:0000514 Slow saccadic eye movements", "HP:0000622 Blurred vision", "HP:0000639 Nystagmus", "HP:0001251 Ataxia", "HP:0001252 Hypotonia", "HP:0001260 Dysarthria", "HP:0001272 Cerebellar atrophy", "HP:0001276 Hypertonia", "HP:0001288 Gait disturbance", "HP:0001308 Tongue fasciculations", "HP:0001310 Dysmetria", "HP:0001324 Muscle weakness", "HP:0001347 Hyperreflexia", "HP:0002015 Dysphagia", "HP:0002066 Gait ataxia", "HP:0002070 Limb ataxia", "HP:0002078 Truncal ataxia", "HP:0002311 Incoordination", "HP:0002380 Fasciculations", "HP:0003202 Skeletal muscle atrophy", "HP:0003445 EMG: neuropathic changes", "HP:0003487 Babinski sign", "HP:0007001 Loss of Purkinje cells in the cerebellar vermis", "HP:0007772 Impaired smooth pursuit", "HP:0012473 Tongue atrophy"], "prevalence": null, "prevalence_details": "Western Japan: 3.6% of all SCA; Costa da Morte region of Spain: 6.3% of all SCA [@pmid:37332636]; US: 0.7% of large undiagnosed ataxia cohort [@pmid:28761930]. Found across ancestries/ethnicities [@omim:614153].", "age_onset": "Typical: 40-60 [@pmid:25101480]; Range: 28 [@pmid:37810464] - 67 [@pmid:37332636].", @@ -3480,7 +3480,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327]. Stroke-like episodes may occur in over one third of patients and can be misdiagnosed as recurrent ischemic stroke [@pmid:36150844; @pmid:35411397]. Often presents with gastrointestinal symptoms, including chronic refractory nausea, which preceded neurologic manifestations by decades in one documented case [@pmid:41929501]. Renal involvement has been reported and may occasionally precede neurological symptoms [@pmid:42643490; @pmid:42058219; @pmid:42005169]. Peripheral neuropathy has been reported in NOTCH2NLC-related NIID [@pmid:42001002], where expansions account for ~1-5.5% of genetically undiagnosed inherited peripheral neuropathy cases, typically motor-dominant [@pmid:42716992]. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.", - "hpo_terms": ["HP:0000020 Urinary incontinence", "HP:0000600 Abnormality of the pharynx", "HP:0000602 Ophthalmoplegia", "HP:0000616 Miosis", "HP:0000639 Nystagmus", "HP:0000648 Optic atrophy", "HP:0000708 Atypical behavior", "HP:0000726 Dementia", "HP:0001250 Seizure", "HP:0001251 Ataxia", "HP:0001260 Dysarthria", "HP:0001265 Hyporeflexia", "HP:0001276 Hypertonia", "HP:0001279 Syncope", "HP:0001288 Gait disturbance", "HP:0001324 Muscle weakness", "HP:0001337 Tremor", "HP:0001347 Hyperreflexia", "HP:0002063 Rigidity", "HP:0002119 Ventriculomegaly", "HP:0002167 Abnormal speech pattern", "HP:0002352 Leukoencephalopathy", "HP:0002353 EEG abnormality", "HP:0002572 Episodic vomiting", "HP:0002650 Scoliosis", "HP:0002922 Increased CSF protein concentration", "HP:0003298 Spina bifida occulta", "HP:0003312 Abnormal vertebral body morphology", "HP:0003403 EMG: decremental response of compound muscle action potential to repetitive nerve stimulation", "HP:0003431 Decreased motor nerve conduction velocity", "HP:0003448 Decreased sensory nerve conduction velocity", "HP:0003457 EMG abnormality", "HP:0003474 Somatic sensory dysfunction", "HP:0007185 Loss of consciousness", "HP:0012229 CSF pleocytosis", "HP:0020068 Intranuclear inclusion bodies", "HP:0100022 Abnormality of movement", "HP:0100543 Cognitive impairment"], + "hpo_terms": ["HP:0000020 Urinary incontinence", "HP:0000405 Conductive hearing impairment", "HP:0000407 Sensorineural hearing impairment", "HP:0000467 Neck muscle weakness", "HP:0000508 Ptosis", "HP:0000580 Pigmentary retinopathy", "HP:0000600 Abnormality of the pharynx", "HP:0000602 Ophthalmoplegia", "HP:0000613 Photophobia", "HP:0000616 Miosis", "HP:0000639 Nystagmus", "HP:0000648 Optic atrophy", "HP:0000708 Atypical behavior", "HP:0000726 Dementia", "HP:0001250 Seizure", "HP:0001251 Ataxia", "HP:0001260 Dysarthria", "HP:0001265 Hyporeflexia", "HP:0001276 Hypertonia", "HP:0001279 Syncope", "HP:0001288 Gait disturbance", "HP:0001324 Muscle weakness", "HP:0001337 Tremor", "HP:0001347 Hyperreflexia", "HP:0002015 Dysphagia", "HP:0002063 Rigidity", "HP:0002119 Ventriculomegaly", "HP:0002167 Abnormal speech pattern", "HP:0002352 Leukoencephalopathy", "HP:0002353 EEG abnormality", "HP:0002572 Episodic vomiting", "HP:0002650 Scoliosis", "HP:0002922 Increased CSF protein concentration", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003298 Spina bifida occulta", "HP:0003312 Abnormal vertebral body morphology", "HP:0003403 EMG: decremental response of compound muscle action potential to repetitive nerve stimulation", "HP:0003431 Decreased motor nerve conduction velocity", "HP:0003448 Decreased sensory nerve conduction velocity", "HP:0003457 EMG abnormality", "HP:0003474 Somatic sensory dysfunction", "HP:0003557 Increased variability in muscle fiber diameter", "HP:0003690 Limb muscle weakness", "HP:0003693 Distal amyotrophy", "HP:0003700 Generalized amyotrophy", "HP:0003805 Rimmed vacuoles", "HP:0007185 Loss of consciousness", "HP:0012229 CSF pleocytosis", "HP:0020068 Intranuclear inclusion bodies", "HP:0030319 Weakness of facial musculature", "HP:0031237 Internally nucleated skeletal muscle fibers", "HP:0100022 Abnormality of movement", "HP:0100297 Increased endomysial connective tissue", "HP:0100543 Cognitive impairment"], "prevalence": null, "prevalence_details": ">400 patients reported in literature [@pmid:37371433]. Found in individuals of East Asian ancestry [@pmid:38876750].", "age_onset": "Typical: 30-70 [@omim:603472]; Range: 7 [@pmid:36948577] - 78 [@pmid:37305750].", @@ -3614,7 +3614,7 @@ "inheritance": ["AD", "AR"], "association_type": ["Mendelian"], "disease_description": "OPMD is a late-onset neuromuscular disease, characterized by ptosis, dysphagia, and general facial weakness [@omim:164300; @pmid:39349043; @pmid:38876750]. Proximal limb weakness commonly develops later in the disease course [@pmid:42157275].", - "hpo_terms": ["HP:0000298 Mask-like facies", "HP:0000467 Neck muscle weakness", "HP:0000508 Ptosis", "HP:0001260 Dysarthria", "HP:0001288 Gait disturbance", "HP:0001611 Hypernasal speech", "HP:0002015 Dysphagia", "HP:0002460 Distal muscle weakness", "HP:0003200 Ragged-red muscle fibers", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003690 Limb muscle weakness", "HP:0003701 Proximal muscle weakness", "HP:0007838 Progressive ptosis", "HP:0010628 Facial palsy"], + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000298 Mask-like facies", "HP:0000467 Neck muscle weakness", "HP:0000508 Ptosis", "HP:0000602 Ophthalmoplegia", "HP:0001260 Dysarthria", "HP:0001288 Gait disturbance", "HP:0001611 Hypernasal speech", "HP:0001618 Dysphonia", "HP:0002015 Dysphagia", "HP:0002460 Distal muscle weakness", "HP:0003198 Myopathy", "HP:0003200 Ragged-red muscle fibers", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003302 Spondylolisthesis", "HP:0003325 Limb-girdle muscle weakness", "HP:0003327 Axial muscle weakness", "HP:0003690 Limb muscle weakness", "HP:0003701 Proximal muscle weakness", "HP:0003805 Rimmed vacuoles", "HP:0004303 Abnormal muscle fiber morphology", "HP:0007838 Progressive ptosis", "HP:0010628 Facial palsy", "HP:0011968 Feeding difficulties", "HP:0012378 Fatigue", "HP:0012473 Tongue atrophy", "HP:0012531 Pain", "HP:0012548 Fatty replacement of skeletal muscle", "HP:0030319 Weakness of facial musculature", "HP:0032342 Reduced forced expiratory volume in one second", "HP:0034045 Angulated muscle fibers", "HP:0100304 Muscle fiber intranuclear inclusion bodies", "HP:6001011 Wet voice"], "prevalence": "1/100000", "prevalence_details": "1/100,000 (population specific) [@pmid:29100084]. Frequency of (GCN)11 alleles is 1-2% of North America/Europe/Japan [@genereviews:NBK1126]. Disease is significantly enriched in individuals of Jewish Bukharian descent [@pmid:42157275]. Disease is found worldwide, in more than 30 countries [@genereviews:NBK1126].", "age_onset": "Typical: 40-59 [@pmid:37519616]; Range: 20-79 [@pmid:35112761].", @@ -4108,7 +4108,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, + "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001336 Myoclonus", "HP:0002197 Generalized-onset seizure", "HP:0002315 Headache", "HP:0002353 EEG abnormality", "HP:0002378 Hand tremor", "HP:0007359 Focal-onset seizure", "HP:0100576 Amaurosis fugax"], "prevalence": null, "prevalence_details": "Observed in a single family from Mali with ten affected individuals [@pmid:37994247].", "age_onset": "7-68 (one family)", @@ -4185,7 +4185,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": ["HP:0001250 Seizure", "HP:0033054 Myoclonic tremor"], + "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001250 Seizure", "HP:0001336 Myoclonus", "HP:0002197 Generalized-onset seizure", "HP:0002315 Headache", "HP:0002353 EEG abnormality", "HP:0002378 Hand tremor", "HP:0007359 Focal-onset seizure", "HP:0033054 Myoclonic tremor", "HP:0100576 Amaurosis fugax"], "prevalence": null, "prevalence_details": "FAME overall is 1/35,000 in Japan. Repeat expansion found in individuals of East Asian ancestry [@pmid:38876750].", "age_onset": "Typical: 20-33 [@pmid:30351492]; Range: 18 [@pmid:29507423] - 37 [@pmid:30351492].", @@ -4339,7 +4339,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750].", - "hpo_terms": ["HP:0000218 High palate", "HP:0000508 Ptosis", "HP:0000544 External ophthalmoplegia", "HP:0000651 Diplopia", "HP:0001260 Dysarthria", "HP:0001284 Areflexia", "HP:0001337 Tremor", "HP:0001611 Hypernasal speech", "HP:0002015 Dysphagia", "HP:0002174 Postural tremor", "HP:0002460 Distal muscle weakness", "HP:0002465 Poor speech", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003458 EMG: myopathic abnormalities", "HP:0003557 Increased variability in muscle fiber diameter", "HP:0003736 Autophagic vacuoles", "HP:0003805 Rimmed vacuoles", "HP:0012548 Fatty replacement of skeletal muscle", "HP:0030319 Weakness of facial musculature"], + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000508 Ptosis", "HP:0000544 External ophthalmoplegia", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0000651 Diplopia", "HP:0001260 Dysarthria", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001337 Tremor", "HP:0001604 Vocal cord paresis", "HP:0001611 Hypernasal speech", "HP:0001824 Weight loss", "HP:0002015 Dysphagia", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002174 Postural tremor", "HP:0002460 Distal muscle weakness", "HP:0002465 Poor speech", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0003236 Elevated circulating creatine kinase activity", "HP:0003458 EMG: myopathic abnormalities", "HP:0003557 Increased variability in muscle fiber diameter", "HP:0003736 Autophagic vacuoles", "HP:0003805 Rimmed vacuoles", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0012548 Fatty replacement of skeletal muscle", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle"], "prevalence": null, "prevalence_details": "Population dependent: 21.6% of one OPDM cohort [@pmid:35148830]. Typically found in individuals of East Asian ancestry [@pmid:38876750].", "age_onset": "Typical: 18-30 [@pmid:35148830]; Range: 10-30 [@pmid:35700120].", @@ -4406,7 +4406,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "A condition that primarily affects the development of the bones and teeth. Characteristic features include underdeveloped or absent collarbones (clavicles); dental abnormalities; and delayed closing of the spaces between the skull bones (fontanels). Other features may include decreased bone density (osteopenia), osteoporosis, hearing loss, bone abnormalities of the hands, and recurrent sinus and ear infections [@mondo:0007340].", - "hpo_terms": ["HP:0000162 Glossoptosis", "HP:0000164 Abnormality of the dentition", "HP:0000175 Cleft palate", "HP:0000189 Narrow palate", "HP:0000218 High palate", "HP:0000239 Large fontanelles", "HP:0000242 Parietal bossing", "HP:0000246 Sinusitis", "HP:0000248 Brachycephaly", "HP:0000256 Macrocephaly", "HP:0000272 Malar flattening", "HP:0000303 Mandibular prognathia", "HP:0000316 Hypertelorism", "HP:0000337 Broad forehead", "HP:0000340 Sloping forehead", "HP:0000347 Micrognathia", "HP:0000364 Hearing abnormality", "HP:0000365 Hearing impairment", "HP:0000389 Chronic otitis media", "HP:0000431 Wide nasal bridge", "HP:0000670 Carious teeth", "HP:0000680 Delayed eruption of primary teeth", "HP:0000682 Abnormal dental enamel morphology", "HP:0000684 Delayed eruption of teeth", "HP:0000696 Delayed eruption of permanent teeth", "HP:0000772 Abnormal rib morphology", "HP:0000773 Short ribs", "HP:0000774 Narrow chest", "HP:0000882 Hypoplastic scapulae", "HP:0000891 Cervical ribs", "HP:0000894 Short clavicles", "HP:0000939 Osteoporosis", "HP:0001156 Brachydactyly", "HP:0001172 Abnormal thumb morphology", "HP:0001182 Tapered finger", "HP:0001810 Dystrophic toenail", "HP:0002007 Frontal bossing", "HP:0002098 Respiratory distress", "HP:0002205 Recurrent respiratory infections", "HP:0002643 Neonatal respiratory distress", "HP:0002644 Abnormal pelvic girdle bone morphology", "HP:0002645 Wormian bones", "HP:0002650 Scoliosis", "HP:0002652 Skeletal dysplasia", "HP:0002659 Increased susceptibility to fractures", "HP:0002684 Thickened calvaria", "HP:0002688 Absent frontal sinuses", "HP:0002689 Absent paranasal sinuses", "HP:0002700 Large foramen magnum", "HP:0002705 High, narrow palate", "HP:0002738 Hypoplastic frontal sinuses", "HP:0002757 Recurrent fractures", "HP:0002808 Kyphosis", "HP:0002812 Coxa vara", "HP:0002827 Hip dislocation", "HP:0002857 Genu valgum", "HP:0002866 Hypoplastic iliac wing", "HP:0003183 Wide pubic symphysis", "HP:0003298 Spina bifida occulta", "HP:0003302 Spondylolisthesis", "HP:0003304 Spondylolysis", "HP:0003396 Syringomyelia", "HP:0004209 Clinodactyly of the 5th finger", "HP:0004220 Short middle phalanx of the 5th finger", "HP:0004322 Short stature", "HP:0004331 Decreased skull ossification", "HP:0004474 Persistent open anterior fontanelle", "HP:0005107 Abnormal sacrum morphology", "HP:0005259 Abnormal facility in opposing the shoulders", "HP:0005280 Depressed nasal bridge", "HP:0005916 Abnormal metacarpal morphology", "HP:0005930 Abnormal epiphysis morphology", "HP:0006040 Long second metacarpal", "HP:0006297 Enamel hypoplasia", "HP:0006660 Aplastic clavicle", "HP:0008391 Dystrophic fingernails", "HP:0008788 Delayed pubic bone ossification", "HP:0008821 Hypoplastic inferior ilia", "HP:0008848 Moderately short stature", "HP:0009577 Short middle phalanx of the 2nd finger", "HP:0010230 Cone-shaped epiphyses of the phalanges of the hand", "HP:0010535 Sleep apnea", "HP:0010669 Hypoplasia of the zygomatic bone", "HP:0010751 Dimple chin", "HP:0010807 Open bite", "HP:0011001 Increased bone mineral density", "HP:0011069 Supernumerary tooth", "HP:0011219 Short face", "HP:0011800 Midface retrusion", "HP:0100864 Short femoral neck", "HP:0200021 Down-sloping shoulders", "HP:6000872 Aplasia/Hypoplasia of the calvaria", "HP:6000875 Wide sacroiliac joint"], + "hpo_terms": ["HP:0000162 Glossoptosis", "HP:0000164 Abnormality of the dentition", "HP:0000175 Cleft palate", "HP:0000189 Narrow palate", "HP:0000218 High palate", "HP:0000239 Large fontanelles", "HP:0000242 Parietal bossing", "HP:0000246 Sinusitis", "HP:0000248 Brachycephaly", "HP:0000256 Macrocephaly", "HP:0000272 Malar flattening", "HP:0000303 Mandibular prognathia", "HP:0000316 Hypertelorism", "HP:0000337 Broad forehead", "HP:0000340 Sloping forehead", "HP:0000347 Micrognathia", "HP:0000364 Hearing abnormality", "HP:0000365 Hearing impairment", "HP:0000389 Chronic otitis media", "HP:0000431 Wide nasal bridge", "HP:0000670 Carious teeth", "HP:0000680 Delayed eruption of primary teeth", "HP:0000682 Abnormal dental enamel morphology", "HP:0000684 Delayed eruption of teeth", "HP:0000696 Delayed eruption of permanent teeth", "HP:0000772 Abnormal rib morphology", "HP:0000773 Short ribs", "HP:0000774 Narrow chest", "HP:0000882 Hypoplastic scapulae", "HP:0000891 Cervical ribs", "HP:0000894 Short clavicles", "HP:0000939 Osteoporosis", "HP:0001156 Brachydactyly", "HP:0001172 Abnormal thumb morphology", "HP:0001182 Tapered finger", "HP:0001810 Dystrophic toenail", "HP:0002007 Frontal bossing", "HP:0002098 Respiratory distress", "HP:0002205 Recurrent respiratory infections", "HP:0002643 Neonatal respiratory distress", "HP:0002644 Abnormal pelvic girdle bone morphology", "HP:0002645 Wormian bones", "HP:0002650 Scoliosis", "HP:0002652 Skeletal dysplasia", "HP:0002659 Increased susceptibility to fractures", "HP:0002684 Thickened calvaria", "HP:0002688 Absent frontal sinuses", "HP:0002689 Absent paranasal sinuses", "HP:0002700 Large foramen magnum", "HP:0002705 High, narrow palate", "HP:0002738 Hypoplastic frontal sinuses", "HP:0002757 Recurrent fractures", "HP:0002808 Kyphosis", "HP:0002812 Coxa vara", "HP:0002827 Hip dislocation", "HP:0002857 Genu valgum", "HP:0002866 Hypoplastic iliac wing", "HP:0003183 Wide pubic symphysis", "HP:0003298 Spina bifida occulta", "HP:0003302 Spondylolisthesis", "HP:0003304 Spondylolysis", "HP:0003396 Syringomyelia", "HP:0004209 Clinodactyly of the 5th finger", "HP:0004220 Short middle phalanx of the 5th finger", "HP:0004322 Short stature", "HP:0004331 Decreased skull ossification", "HP:0004474 Persistent open anterior fontanelle", "HP:0005107 Abnormal sacrum morphology", "HP:0005259 Abnormal facility in opposing the shoulders", "HP:0005280 Depressed nasal bridge", "HP:0005916 Abnormal metacarpal morphology", "HP:0005930 Abnormal epiphysis morphology", "HP:0006040 Long second metacarpal", "HP:0006297 Enamel hypoplasia", "HP:0006660 Aplastic clavicle", "HP:0008391 Dystrophic fingernails", "HP:0008788 Delayed pubic bone ossification", "HP:0008821 Hypoplastic inferior ilia", "HP:0008848 Moderately short stature", "HP:0009577 Short middle phalanx of the 2nd finger", "HP:0010230 Cone-shaped epiphyses of the phalanges of the hand", "HP:0010535 Sleep apnea", "HP:0010669 Hypoplasia of the zygomatic bone", "HP:0010751 Dimple chin", "HP:0010807 Open bite", "HP:0011001 Increased bone mineral density", "HP:0011069 Supernumerary tooth", "HP:0011219 Short face", "HP:0011800 Midface retrusion", "HP:0100864 Short femoral neck", "HP:0200021 Down-sloping shoulder", "HP:6000872 Aplasia/Hypoplasia of the calvaria", "HP:6000875 Wide sacroiliac joint"], "prevalence": null, "prevalence_details": "All conditions 1/1,000,000 births (likely underdiagnosed); Utah population frequency 0.12/10,000. Found in many ethnic groups [@orphanet:1452]. TR expansions causative in 2 individuals [@genereviews:NBK535148].", "age_onset": "0 (birth) [@genereviews:NBK1513].", @@ -4483,7 +4483,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical myoclonus, with seizures in up to a half of patients [@pmid:39349043].", - "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001312 Giant somatosensory evoked potentials", "HP:0001326 EEG with irregular generalized spike and wave complexes", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002123 Generalized myoclonic seizure", "HP:0010852 EEG with photoparoxysmal response"], + "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001312 Giant somatosensory evoked potentials", "HP:0001326 EEG with irregular generalized spike and wave complexes", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002123 Generalized myoclonic seizure", "HP:0002197 Generalized-onset seizure", "HP:0002315 Headache", "HP:0002353 EEG abnormality", "HP:0002378 Hand tremor", "HP:0007359 Focal-onset seizure", "HP:0010852 EEG with photoparoxysmal response", "HP:0100576 Amaurosis fugax"], "prevalence": null, "prevalence_details": "FAME overall is 1/35,000 in Japan. Typically found in individuals of East Asian ancestry [@pmid:38876750].", "age_onset": "Typical: 21-39 [@pmid:29939203]; Range: 8 [@pmid:40503331] - 68 [@pmid:29507423].", @@ -4560,7 +4560,7 @@ "inheritance": ["XR"], "association_type": ["Mendelian"], "disease_description": "X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD), also known as X-linked panhypopituitarism (PHPX), patients with or without intellectual disability [@pmid:24346842].", - "hpo_terms": ["HP:0000821 Hypothyroidism", "HP:0000824 Decreased response to growth hormone stimulation test", "HP:0000871 Panhypopituitarism", "HP:0001256 Mild intellectual disability", "HP:0001263 Global developmental delay", "HP:0004322 Short stature"], + "hpo_terms": ["HP:0000570 Abnormal saccadic eye movements", "HP:0000657 Oculomotor apraxia", "HP:0000821 Hypothyroidism", "HP:0000824 Decreased response to growth hormone stimulation test", "HP:0000839 Pituitary dwarfism", "HP:0000871 Panhypopituitarism", "HP:0001249 Intellectual disability", "HP:0001256 Mild intellectual disability", "HP:0001263 Global developmental delay", "HP:0002079 Hypoplasia of the corpus callosum", "HP:0002750 Delayed skeletal maturation", "HP:0004322 Short stature", "HP:0007979 Gaze-evoked horizontal nystagmus", "HP:0010627 Anterior pituitary hypoplasia", "HP:0011342 Mild global developmental delay", "HP:0011755 Ectopic posterior pituitary", "HP:0012447 Abnormal myelination", "HP:0030353 Decreased circulating insulin-like growth factor 1 concentration", "HP:0040010 Small posterior fossa"], "prevalence": null, "prevalence_details": "3 families reported, however they were distributed across the world [@omim:300123].", "age_onset": "Typical: 0-3 (small sample size) [@pmid:19654509; @pmid:21289259]; range: 0-9 [@pmid:19654509].", @@ -4627,7 +4627,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Finger, hand tremor with later-onset myoclonus and generalised tonic-clonic seizures [@pmid:39349043].", - "hpo_terms": ["HP:0000643 Blepharospasm", "HP:0000726 Dementia", "HP:0001249 Intellectual disability", "HP:0001251 Ataxia", "HP:0001312 Giant somatosensory evoked potentials", "HP:0001326 EEG with irregular generalized spike and wave complexes", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002076 Migraine", "HP:0010852 EEG with photoparoxysmal response", "HP:0100543 Cognitive impairment"], + "hpo_terms": ["HP:0000643 Blepharospasm", "HP:0000726 Dementia", "HP:0001249 Intellectual disability", "HP:0001251 Ataxia", "HP:0001312 Giant somatosensory evoked potentials", "HP:0001326 EEG with irregular generalized spike and wave complexes", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002076 Migraine", "HP:0002197 Generalized-onset seizure", "HP:0002315 Headache", "HP:0002353 EEG abnormality", "HP:0002378 Hand tremor", "HP:0007359 Focal-onset seizure", "HP:0010852 EEG with photoparoxysmal response", "HP:0100543 Cognitive impairment", "HP:0100576 Amaurosis fugax"], "prevalence": null, "prevalence_details": "This repeat expansion is typically found in individuals of European ancestry [@pmid:38876750].", "age_onset": "Typical: 12-30; Range: 4-60 [@pmid:31664034].", @@ -4771,7 +4771,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "This is a newly proposed locus for OPDM, only having been reported in one paper [@pmid:41959811]. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0008997 Proximal upper limb muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0010550 Paraplegia", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle", "HP:3000010 Abnormality of orbicularis oris muscle"], + "hpo_terms": ["HP:0000183 Tongue muscle weakness", "HP:0000218 High palate", "HP:0000301 Abnormality of facial musculature", "HP:0000408 Progressive sensorineural hearing impairment", "HP:0000590 Progressive external ophthalmoplegia", "HP:0000597 Ophthalmoparesis", "HP:0001284 Areflexia", "HP:0001288 Gait disturbance", "HP:0001604 Vocal cord paresis", "HP:0001824 Weight loss", "HP:0002058 Myopathic facies", "HP:0002091 Restrictive ventilatory defect", "HP:0002100 Recurrent aspiration pneumonia", "HP:0002505 Loss of ambulation", "HP:0002705 High, narrow palate", "HP:0002747 Respiratory insufficiency due to muscle weakness", "HP:0007149 Distal upper limb amyotrophy", "HP:0007838 Progressive ptosis", "HP:0008376 Nasal dysarthria", "HP:0008756 Bowing of the vocal cords", "HP:0008944 Distal lower limb amyotrophy", "HP:0008959 Distal upper limb muscle weakness", "HP:0008963 Tibialis muscle weakness", "HP:0009027 Foot dorsiflexor weakness", "HP:0009053 Distal lower limb muscle weakness", "HP:0009063 Progressive distal muscle weakness", "HP:0009073 Progressive proximal muscle weakness", "HP:0030192 Fatigable weakness of bulbar muscles", "HP:0030319 Weakness of facial musculature", "HP:0031162 Impaired oropharyngeal swallow response", "HP:0200136 Oral-pharyngeal dysphagia", "HP:0430015 Abnormal morphology of musculature of pharynx", "HP:3000005 Abnormality of masseter muscle"], "prevalence": null, "prevalence_details": "Found in 3 families (7 total patients) of European ancestry [@pmid:41959811].", "age_onset": "2nd to 6th decade (3/5 patients had onset in 2nd decade). Referred to as adult onset, so assuming high end of 2nd decade [@pmid:41959811].", @@ -4972,7 +4972,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Late-onset Fuchs endothelial corneal dystrophy (FECD) is a degenerative disorder, distinguished from other corneal disorders by the progressive formation of guttae [@omim:613267]. Studies suggest that disease severity increases in women with greater lifetime exposure to estrogen [@pmid:40374208].", - "hpo_terms": ["HP:0000505 Visual impairment", "HP:0007957 Corneal opacity", "HP:0012038 Corneal guttata", "HP:0012040 Corneal stromal edema"], + "hpo_terms": ["HP:0000505 Visual impairment", "HP:0000572 Visual loss", "HP:0000662 Nyctalopia", "HP:0000969 Edema", "HP:0007663 Reduced visual acuity", "HP:0007957 Corneal opacity", "HP:0011488 Abnormal corneal endothelium morphology", "HP:0011490 Abnormal Descemet membrane morphology", "HP:0011491 Reduced number of corneal endothelial cells", "HP:0012038 Corneal guttata", "HP:0012040 Corneal stromal edema", "HP:0030857 Eye movement-induced pain"], "prevalence": "4.5/100", "prevalence_details": "~4/100 (over 40) [@omim:613267]; 5/100 [@pmid:20825314]. Predominantly in women (~75%) [@pmid:16769829]. In one study of two cohorts (Dallas Heart Study and 1000 Genomes Project), expanded allele carrier rates were 3.1% (African American), 8.1% (European American), and 3.3% (Latinos) in DHS, and 2.7% (AFR), 9.5% (EUR), 5.2% (East Asians), 7.2% (South Asians), and 5.2% (admixed Americans) in 1KGP [@pmid:39669694]. The highest carrier prevalence (12.1%–12.5%) occurred in EUR and admixed American subpopulations, while rates were 0%–1.9% in West Africans vs 6.2% in a Kenyan subpopulation.", "age_onset": "Typical: 40-59 [@pmid:1676829]; Range: 32 [@pmid:21245398] - 79 [@pmid:39998965].", @@ -5106,7 +5106,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": ["HP:0033054 Myoclonic tremor"], + "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001336 Myoclonus", "HP:0002197 Generalized-onset seizure", "HP:0002315 Headache", "HP:0002353 EEG abnormality", "HP:0002378 Hand tremor", "HP:0007359 Focal-onset seizure", "HP:0033054 Myoclonic tremor", "HP:0100576 Amaurosis fugax"], "prevalence": null, "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", "age_onset": "Limited clinical details from one family, 'early 20s to 70s'.", @@ -5317,7 +5317,7 @@ "inheritance": ["AR"], "association_type": ["Mendelian"], "disease_description": "Desbuquois dysplasia, which belongs to the multiple dislocation group of disorders, is characterized by dislocations of large joints, severe pre- and postnatal growth retardation, joint laxity, and flat face with prominent eyes. Radiologic features include short long bones with an exaggerated trochanter that gives a 'monkey wrench' appearance to the proximal femur, and advanced carpal and tarsal ossification [@pmid:24581741].", - "hpo_terms": ["HP:0000175 Cleft palate", "HP:0000193 Bifid uvula", "HP:0000252 Microcephaly", "HP:0000280 Coarse facial features", "HP:0000286 Epicanthus", "HP:0000311 Round face", "HP:0000343 Long philtrum", "HP:0000470 Short neck", "HP:0000520 Proptosis", "HP:0000592 Blue sclerae", "HP:0000664 Synophrys", "HP:0000668 Hypodontia", "HP:0000678 Dental crowding", "HP:0000750 Delayed speech and language development", "HP:0000767 Pectus excavatum", "HP:0000768 Pectus carinatum", "HP:0000774 Narrow chest", "HP:0000894 Short clavicles", "HP:0000926 Platyspondyly", "HP:0000954 Single transverse palmar crease", "HP:0001249 Intellectual disability", "HP:0001252 Hypotonia", "HP:0001263 Global developmental delay", "HP:0001382 Joint hypermobility", "HP:0001511 Intrauterine growth retardation", "HP:0001763 Pes planus", "HP:0001769 Broad foot", "HP:0001840 Metatarsus adductus", "HP:0001863 Toe clinodactyly", "HP:0001956 Truncal obesity", "HP:0002643 Neonatal respiratory distress", "HP:0002656 Epiphyseal dysplasia", "HP:0002673 Coxa valga", "HP:0002827 Hip dislocation", "HP:0002938 Lumbar hyperlordosis", "HP:0002970 Genu varum", "HP:0003016 Metaphyseal widening", "HP:0003026 Short long bone", "HP:0003048 Radial head subluxation", "HP:0003180 Flat acetabular roof", "HP:0003510 Severe short stature", "HP:0004233 Advanced ossification of carpal bones", "HP:0004482 Relative macrocephaly", "HP:0004976 Knee dislocation", "HP:0005280 Depressed nasal bridge", "HP:0008897 Postnatal growth retardation", "HP:0009803 Short phalanx of finger", "HP:0010049 Short metacarpal", "HP:0011304 Broad thumb", "HP:0012368 Flat face", "HP:0012725 Cutaneous syndactyly", "HP:0031936 Delayed ability to walk", "HP:0033102 Monkey wrench femoral neck", "HP:6000816 Prominent lesser trochanter"], + "hpo_terms": ["HP:0000175 Cleft palate", "HP:0000193 Bifid uvula", "HP:0000252 Microcephaly", "HP:0000280 Coarse facial features", "HP:0000286 Epicanthus", "HP:0000311 Round face", "HP:0000343 Long philtrum", "HP:0000358 Posteriorly rotated ears", "HP:0000463 Anteverted nares", "HP:0000470 Short neck", "HP:0000499 Abnormal eyelash morphology", "HP:0000501 Glaucoma", "HP:0000520 Proptosis", "HP:0000592 Blue sclerae", "HP:0000664 Synophrys", "HP:0000668 Hypodontia", "HP:0000678 Dental crowding", "HP:0000750 Delayed speech and language development", "HP:0000767 Pectus excavatum", "HP:0000768 Pectus carinatum", "HP:0000774 Narrow chest", "HP:0000894 Short clavicles", "HP:0000926 Platyspondyly", "HP:0000944 Abnormal metaphysis morphology", "HP:0000954 Single transverse palmar crease", "HP:0001249 Intellectual disability", "HP:0001252 Hypotonia", "HP:0001263 Global developmental delay", "HP:0001382 Joint hypermobility", "HP:0001511 Intrauterine growth retardation", "HP:0001591 Bell-shaped thorax", "HP:0001629 Ventricular septal defect", "HP:0001763 Pes planus", "HP:0001769 Broad foot", "HP:0001840 Metatarsus adductus", "HP:0001863 Toe clinodactyly", "HP:0001956 Truncal obesity", "HP:0002643 Neonatal respiratory distress", "HP:0002650 Scoliosis", "HP:0002656 Epiphyseal dysplasia", "HP:0002673 Coxa valga", "HP:0002812 Coxa vara", "HP:0002816 Genu recurvatum", "HP:0002827 Hip dislocation", "HP:0002938 Lumbar hyperlordosis", "HP:0002970 Genu varum", "HP:0002974 Radioulnar synostosis", "HP:0002999 Patellar dislocation", "HP:0003016 Metaphyseal widening", "HP:0003026 Short long bone", "HP:0003042 Elbow dislocation", "HP:0003048 Radial head subluxation", "HP:0003180 Flat acetabular roof", "HP:0003366 Abnormal femoral neck/head morphology", "HP:0003510 Severe short stature", "HP:0004209 Clinodactyly of the 5th finger", "HP:0004233 Advanced ossification of carpal bones", "HP:0004482 Relative macrocephaly", "HP:0004976 Knee dislocation", "HP:0005280 Depressed nasal bridge", "HP:0005616 Accelerated skeletal maturation", "HP:0008070 Sparse hair", "HP:0008873 Disproportionate short-limb short stature", "HP:0008897 Postnatal growth retardation", "HP:0009803 Short phalanx of finger", "HP:0010049 Short metacarpal", "HP:0010318 Aplasia/Hypoplasia of the abdominal wall musculature", "HP:0011304 Broad thumb", "HP:0012368 Flat face", "HP:0012725 Cutaneous syndactyly", "HP:0031936 Delayed ability to walk", "HP:0033102 Monkey wrench femoral neck", "HP:0100490 Camptodactyly of finger", "HP:0200055 Small hand", "HP:6000816 Prominent lesser trochanter"], "prevalence": null, "prevalence_details": "<1/1,000,000 births [@orphanet:1425]; repeat expansions comprise half of DBQD variants [@genereviews:NBK535148]. <50 DBQD cases. Has been found in Belgian and Emirati families.", "age_onset": "0 (birth)", @@ -5399,7 +5399,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001250 Seizure", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002392 EEG with polyspike wave complexes"], + "hpo_terms": ["HP:0001249 Intellectual disability", "HP:0001250 Seizure", "HP:0001336 Myoclonus", "HP:0001337 Tremor", "HP:0001340 Enhancement of the C-reflex", "HP:0001351 Jerk-locked premyoclonus spikes", "HP:0002069 Bilateral tonic-clonic seizure", "HP:0002197 Generalized-onset seizure", "HP:0002315 Headache", "HP:0002353 EEG abnormality", "HP:0002378 Hand tremor", "HP:0002392 EEG with polyspike wave complexes", "HP:0007359 Focal-onset seizure", "HP:0100576 Amaurosis fugax"], "prevalence": null, "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", "age_onset": "Typical: 20-25 [@pmid:22713812]; Range: 10-33 [@pmid:31539032].", @@ -5543,7 +5543,7 @@ "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Holoprosencephaly associated with mutations in the ZIC2 gene [@mondo:0012322].", - "hpo_terms": ["HP:0000202 Orofacial cleft", "HP:0000218 High palate", "HP:0000238 Hydrocephalus", "HP:0000243 Trigonocephaly", "HP:0000252 Microcephaly", "HP:0000316 Hypertelorism", "HP:0000337 Broad forehead", "HP:0000340 Sloping forehead", "HP:0000341 Narrow forehead", "HP:0000348 High forehead", "HP:0000400 Macrotia", "HP:0000463 Anteverted nares", "HP:0000520 Proptosis", "HP:0000582 Upslanted palpebral fissure", "HP:0000601 Hypotelorism", "HP:0000664 Synophrys", "HP:0000863 Central diabetes insipidus", "HP:0001249 Intellectual disability", "HP:0001250 Seizure", "HP:0001263 Global developmental delay", "HP:0001272 Cerebellar atrophy", "HP:0001347 Hyperreflexia", "HP:0001360 Holoprosencephaly", "HP:0002002 Deep philtrum", "HP:0002119 Ventriculomegaly", "HP:0002507 Semilobar holoprosencephaly", "HP:0005280 Depressed nasal bridge", "HP:0006870 Lobar holoprosencephaly", "HP:0006956 Lateral ventricle dilatation", "HP:0006988 Alobar holoprosencephaly", "HP:0012385 Camptodactyly", "HP:0025670 Syntelencephaly", "HP:0032549 Persistent asymmetrical tonic neck reflex", "HP:0100702 Arachnoid cyst"], + "hpo_terms": ["HP:0000028 Cryptorchidism", "HP:0000079 Abnormality of the urinary system", "HP:0000093 Proteinuria", "HP:0000161 Median cleft upper lip", "HP:0000202 Orofacial cleft", "HP:0000218 High palate", "HP:0000238 Hydrocephalus", "HP:0000243 Trigonocephaly", "HP:0000252 Microcephaly", "HP:0000256 Macrocephaly", "HP:0000286 Epicanthus", "HP:0000289 Broad philtrum", "HP:0000316 Hypertelorism", "HP:0000337 Broad forehead", "HP:0000340 Sloping forehead", "HP:0000341 Narrow forehead", "HP:0000348 High forehead", "HP:0000377 Abnormal pinna morphology", "HP:0000400 Macrotia", "HP:0000437 Depressed nasal tip", "HP:0000453 Choanal atresia", "HP:0000457 Depressed nasal ridge", "HP:0000458 Anosmia", "HP:0000463 Anteverted nares", "HP:0000470 Short neck", "HP:0000488 Retinopathy", "HP:0000490 Deeply set eye", "HP:0000508 Ptosis", "HP:0000520 Proptosis", "HP:0000528 Anophthalmia", "HP:0000567 Chorioretinal coloboma", "HP:0000568 Microphthalmia", "HP:0000574 Thick eyebrow", "HP:0000581 Blepharophimosis", "HP:0000582 Upslanted palpebral fissure", "HP:0000601 Hypotelorism", "HP:0000612 Iris coloboma", "HP:0000648 Optic atrophy", "HP:0000664 Synophrys", "HP:0000776 Congenital diaphragmatic hernia", "HP:0000819 Diabetes mellitus", "HP:0000830 Anterior hypopituitarism", "HP:0000863 Central diabetes insipidus", "HP:0000871 Panhypopituitarism", "HP:0000873 Diabetes insipidus", "HP:0000929 Abnormal skull morphology", "HP:0001156 Brachydactyly", "HP:0001161 Hand polydactyly", "HP:0001249 Intellectual disability", "HP:0001250 Seizure", "HP:0001252 Hypotonia", "HP:0001257 Spasticity", "HP:0001263 Global developmental delay", "HP:0001272 Cerebellar atrophy", "HP:0001305 Dandy-Walker malformation", "HP:0001324 Muscle weakness", "HP:0001332 Dystonia", "HP:0001347 Hyperreflexia", "HP:0001360 Holoprosencephaly", "HP:0001382 Joint hypermobility", "HP:0001531 Failure to thrive in infancy", "HP:0001539 Omphalocele", "HP:0001629 Ventricular septal defect", "HP:0001636 Tetralogy of Fallot", "HP:0001641 Abnormal pulmonary valve morphology", "HP:0001679 Abnormal aortic morphology", "HP:0001743 Abnormality of the spleen", "HP:0001883 Talipes", "HP:0001943 Hypoglycemia", "HP:0001999 Abnormal facial shape", "HP:0002002 Deep philtrum", "HP:0002007 Frontal bossing", "HP:0002019 Constipation", "HP:0002020 Gastroesophageal reflux", "HP:0002072 Chorea", "HP:0002084 Encephalocele", "HP:0002093 Respiratory insufficiency", "HP:0002119 Ventriculomegaly", "HP:0002269 Abnormality of neuronal migration", "HP:0002507 Semilobar holoprosencephaly", "HP:0002553 Highly arched eyebrow", "HP:0002650 Scoliosis", "HP:0002902 Hyponatremia", "HP:0003312 Abnormal vertebral body morphology", "HP:0004409 Hyposmia", "HP:0005280 Depressed nasal bridge", "HP:0005469 Flat occiput", "HP:0006315 Solitary median maxillary central incisor", "HP:0006703 Aplasia/Hypoplasia of the lungs", "HP:0006870 Lobar holoprosencephaly", "HP:0006956 Lateral ventricle dilatation", "HP:0006988 Alobar holoprosencephaly", "HP:0007360 Aplasia/Hypoplasia of the cerebellum", "HP:0007370 Aplasia/Hypoplasia of the corpus callosum", "HP:0008736 Hypoplasia of penis", "HP:0008872 Feeding difficulties in infancy", "HP:0009099 Median cleft palate", "HP:0009738 Abnormal antihelix morphology", "HP:0009794 Branchial anomaly", "HP:0009804 Tooth agenesis", "HP:0009914 Cyclopia", "HP:0009924 Aplasia/Hypoplasia involving the nose", "HP:0010301 Spinal dysraphism", "HP:0010302 Spinal cord tumor", "HP:0010669 Hypoplasia of the zygomatic bone", "HP:0011100 Intestinal atresia", "HP:0011675 Arrhythmia", "HP:0012385 Camptodactyly", "HP:0012639 Abnormal nervous system morphology", "HP:0025670 Syntelencephaly", "HP:0032549 Persistent asymmetrical tonic neck reflex", "HP:0100336 Bilateral cleft lip", "HP:0100543 Cognitive impairment", "HP:0100596 Absent nares", "HP:0100702 Arachnoid cyst"], "prevalence": "1.4/1000000", "prevalence_details": "0.05-0.23/100,000; math done by 40% of pathogenic variants in ZIC2 are expansion [@genereviews:NBK1530]; 5% of non-syndromic HPE are ZIC2 gene [@genereviews:NBK1530], and nonsyndromic HPE is 25-50% of HPE, which affects 1/10,000 newborns [@url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/] - ZIC2 is 9.2% of HPE cases, which occur in 1/16,000 live births [@pmid:17274816]. Holoprosencephaly has worldwide distribution [@orphanet:2162], but STR-specific distribution is unknown.", "age_onset": "0", From 518c2a1a92e95ce678a3d784573bf46988a349b6 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 17:56:21 -0600 Subject: [PATCH 09/18] Rename SD5_HOXD13 to SPD1_HOXD13 All of the locus's IDs (OMIM 186000, MONDO:0008513, ORPHA:295195) are for synpolydactyly 1, not syndactyly type V (OMIM 186300). Update the locus ID, disease ID and disease name ("Synpolydactyly 1"), the criTRia curation (including "type 5" -> "type 1" in its description) and plots/gnomad.json. Co-Authored-By: Claude Opus 5.5 --- data/STRchive-loci.json | 6 +++--- data/criTRia-curations.json | 6 +++--- data/plots/gnomad.json | 4 ++-- 3 files changed, 8 insertions(+), 8 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 1bf36187..15f08070 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -2760,8 +2760,8 @@ "additional_literature": ["pmid:32386547", "pmid:23532960", "pmid:19591980", "pmid:12414828", "pmid:11543619"] }, { - "id": "SD5_HOXD13", - "disease_id": "SD5", + "id": "SPD1_HOXD13", + "disease_id": "SPD1", "gene": "HOXD13", "evidence": ["Definitive"], "chrom": "chr2", @@ -2771,7 +2771,7 @@ "stop_hg19": 176957831, "start_t2t": 176581179, "stop_t2t": 176581224, - "disease": "Syndactyly", + "disease": "Synpolydactyly 1", "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Synpolydactyly (SPD), or syndactyly type II, is defined as a connection between the middle and ring fingers and fourth and fifth toes, variably associated with postaxial polydactyly in the same digits. Minor local anomalies and various metacarpal or metatarsal abnormalities may be present [@omim:186000].", diff --git a/data/criTRia-curations.json b/data/criTRia-curations.json index e757f045..53f3a06f 100644 --- a/data/criTRia-curations.json +++ b/data/criTRia-curations.json @@ -3236,14 +3236,14 @@ "classification": "Limited" }, { - "Disease_ID": "SD5", + "Disease_ID": "SPD1", "Gene": "HOXD13", - "Locus_ID": "SD5_HOXD13", + "Locus_ID": "SPD1_HOXD13", "Inheritance": "AD", "Curator": "Macayla Weiner", "Contributors": "Laurel Hiatt, Harriet Dashnow", "Date": "08/18/2025", - "Description": "Autosomal dominant synpolydactyly type 5 is associated with in-frame polyalanine expansions in exon 1 of HOXD13, a coding tandem-repeat tract outside the DNA-binding homeodomain. Published families show HOXD13 polyalanine expansions segregating with synpolydactyly, with expansion size correlating with penetrance and limb phenotype severity. Functional studies in a Hoxd13 +7A synpolydactyly mouse model and transcription-factor condensate assays support a repeat-expansion mechanism that alters HOXD13 condensate composition and downstream transcriptional programs during limb development.", + "Description": "Autosomal dominant synpolydactyly type 1 is associated with in-frame polyalanine expansions in exon 1 of HOXD13, a coding tandem-repeat tract outside the DNA-binding homeodomain. Published families show HOXD13 polyalanine expansions segregating with synpolydactyly, with expansion size correlating with penetrance and limb phenotype severity. Functional studies in a Hoxd13 +7A synpolydactyly mouse model and transcription-factor condensate assays support a repeat-expansion mechanism that alters HOXD13 condensate composition and downstream transcriptional programs during limb development.", "Source": "criTRia", "SOP_version": "criTRia v0", "Manual_evidence_level": null, diff --git a/data/plots/gnomad.json b/data/plots/gnomad.json index 28699859..86c59d03 100644 --- a/data/plots/gnomad.json +++ b/data/plots/gnomad.json @@ -539,11 +539,11 @@ }, "reliable": false }, - "SD5_HOXD13": + "SPD1_HOXD13": { "both": { - "id": "SD5_HOXD13", + "id": "SPD1_HOXD13", "labels": ["Admixed American", "African/African American", "Amish", "Ashkenazi Jewish", "European (non Finnish)", "Finnish", "Middle Eastern", "South Asian", "East Asian", "Others"], "values": [0, 0, 0, 0, 0.028951939779965255, 0, 0, 0, 0, 0], "counts": [612, 6896, 52, 360, 6908, 2104, 117, 662, 693, 104], From f14a9eedd9903343b3a460f17ac6d4503e123f09 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 17:56:21 -0600 Subject: [PATCH 10/18] Add omim_gene field and keep omim for disease entries New omim_gene field holds the OMIM gene entry for each locus, filled for all 82 loci from HGNC by scripts/getOMIMgene.py and linked on locus pages as "OMIM Gene". omim is now documented as phenotype IDs only; gene IDs that were stored there moved to omim_gene for FRA2A_AFF3, FRAXG_BCLAF3, EPM_CSNK1E, OPDM_FAM193B, OPDM_TBC1D7, FRA7A_ZNF713 and aFTLD-U_GOLGA8A. Co-Authored-By: Claude Opus 5.5 --- data/STRchive-loci.json | 96 ++++++++++++++++++++++++++++++--- data/STRchive-loci.schema.json | 16 +++++- scripts/check-loci.py | 1 + scripts/getOMIMgene.py | 98 ++++++++++++++++++++++++++++++++++ site/src/data/identifiers.ts | 7 +++ 5 files changed, 210 insertions(+), 8 deletions(-) create mode 100644 scripts/getOMIMgene.py diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 15f08070..92f10399 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -55,6 +55,7 @@ "medgen": ["320250"], "mondo": ["0025193"], "omim": [], + "omim_gene": ["170995"], "orphanet": ["98897"], "gnomad": ["ABCD3"], "stripy": [], @@ -122,6 +123,7 @@ "medgen": ["155512"], "mondo": ["0010659"], "omim": ["309548"], + "omim_gene": ["300806"], "orphanet": ["100973"], "gnomad": ["AFF2"], "stripy": ["AFF2"], @@ -188,7 +190,8 @@ "malacard": ["KNS007"], "medgen": [], "mondo": [], - "omim": ["601464"], + "omim": [], + "omim_gene": ["601464"], "orphanet": [], "gnomad": ["AFF3"], "stripy": [], @@ -256,6 +259,7 @@ "medgen": ["333282"], "mondo": ["0010735"], "omim": ["313200"], + "omim_gene": ["313700"], "orphanet": ["481"], "gnomad": ["AR"], "stripy": ["AR"], @@ -323,6 +327,7 @@ "medgen": ["483052"], "mondo": ["0010632"], "omim": ["308350", "300419"], + "omim_gene": ["300382"], "orphanet": ["182079", "1934"], "gnomad": ["ARX_1"], "stripy": ["ARX_1"], @@ -390,6 +395,7 @@ "medgen": ["163237"], "mondo": ["0010654"], "omim": ["309510"], + "omim_gene": ["300382"], "orphanet": ["94083"], "gnomad": ["ARX_2"], "stripy": ["ARX_2"], @@ -457,6 +463,7 @@ "medgen": ["155630"], "mondo": ["0007435"], "omim": ["125370"], + "omim_gene": ["607462"], "orphanet": ["101"], "gnomad": ["ATN1"], "stripy": ["ATN1"], @@ -524,6 +531,7 @@ "medgen": ["155703"], "mondo": ["0008119"], "omim": ["164400"], + "omim_gene": ["601556"], "orphanet": ["98755"], "gnomad": ["ATXN1"], "stripy": ["ATXN1"], @@ -591,6 +599,7 @@ "medgen": ["369786"], "mondo": ["0011330"], "omim": ["603516"], + "omim_gene": ["611150"], "orphanet": ["98761"], "gnomad": ["ATXN10"], "stripy": ["ATXN10"], @@ -658,6 +667,7 @@ "medgen": ["155704"], "mondo": ["0008458"], "omim": ["183090"], + "omim_gene": ["601517"], "orphanet": ["98756"], "gnomad": ["ATXN2"], "stripy": ["ATXN2"], @@ -725,6 +735,7 @@ "medgen": ["9841"], "mondo": ["0007182"], "omim": ["109150"], + "omim_gene": ["607047"], "orphanet": ["98757"], "gnomad": ["ATXN3"], "stripy": ["ATXN3"], @@ -802,6 +813,7 @@ "medgen": ["156006"], "mondo": ["0016163"], "omim": ["164500"], + "omim_gene": ["607640"], "orphanet": ["94147", "208508"], "gnomad": ["ATXN7"], "stripy": ["ATXN7"], @@ -879,6 +891,7 @@ "medgen": ["332457"], "mondo": ["0012116"], "omim": ["608768"], + "omim_gene": ["603680"], "orphanet": ["98760"], "gnomad": ["ATXN8OS"], "stripy": ["ATXN8OS"], @@ -945,7 +958,8 @@ "malacard": [], "medgen": [], "mondo": [], - "omim": ["301159"], + "omim": [], + "omim_gene": ["301159"], "orphanet": [], "gnomad": [], "stripy": [], @@ -1013,6 +1027,7 @@ "medgen": ["348439"], "mondo": ["0007296"], "omim": ["117210"], + "omim_gene": ["612051"], "orphanet": ["217012"], "gnomad": ["BEAN1"], "stripy": ["BEAN1"], @@ -1080,6 +1095,7 @@ "medgen": ["1830423"], "mondo": ["0007105", "0004976"], "omim": ["105550"], + "omim_gene": ["614260"], "orphanet": ["275872"], "gnomad": ["C9ORF72"], "stripy": ["C9ORF72"], @@ -1147,6 +1163,7 @@ "medgen": ["148458"], "mondo": ["0008457"], "omim": ["183086"], + "omim_gene": ["601011"], "orphanet": ["98758"], "gnomad": ["CACNA1A"], "stripy": ["CACNA1A"], @@ -1214,6 +1231,7 @@ "medgen": ["162878"], "mondo": ["0007838"], "omim": ["147791"], + "omim_gene": ["165360"], "orphanet": ["2308"], "gnomad": ["CBL"], "stripy": ["CBL"], @@ -1286,6 +1304,7 @@ "medgen": ["342845"], "mondo": ["0012348"], "omim": ["609812"], + "omim_gene": ["114840"], "orphanet": ["552"], "gnomad": [], "stripy": [], @@ -1368,6 +1387,7 @@ "medgen": ["419137"], "mondo": ["0011266"], "omim": ["602668"], + "omim_gene": ["116955"], "orphanet": ["606"], "gnomad": ["CNBP"], "stripy": ["CNBP"], @@ -1435,6 +1455,7 @@ "medgen": ["98378", "325376"], "mondo": ["0008322", "0007561"], "omim": ["132400", "177170"], + "omim_gene": ["600310"], "orphanet": ["750", "93308"], "gnomad": ["COMP"], "stripy": ["COMP"], @@ -1506,7 +1527,8 @@ "malacard": ["MYC080"], "medgen": ["199732"], "mondo": ["0020074"], - "omim": ["600863"], + "omim": [], + "omim_gene": ["600863"], "orphanet": [], "gnomad": ["CSNK1E"], "stripy": [], @@ -1574,6 +1596,7 @@ "medgen": ["155923"], "mondo": ["0009698"], "omim": ["254800"], + "omim_gene": ["601145"], "orphanet": ["308"], "gnomad": ["CSTB"], "stripy": [], @@ -1651,6 +1674,7 @@ "medgen": ["855217"], "mondo": ["0014410"], "omim": ["615945"], + "omim_gene": ["603448"], "orphanet": ["363710"], "gnomad": ["DAB1"], "stripy": ["DAB1"], @@ -1718,6 +1742,7 @@ "medgen": ["369613"], "mondo": ["0007634"], "omim": ["136630"], + "omim_gene": ["611379"], "orphanet": [], "gnomad": ["DIP2B"], "stripy": ["DIP2B"], @@ -1795,6 +1820,7 @@ "medgen": ["3925"], "mondo": ["0010679"], "omim": ["310200"], + "omim_gene": ["300377"], "orphanet": ["98896"], "gnomad": ["DMD"], "stripy": ["DMD"], @@ -1862,6 +1888,7 @@ "medgen": ["886881"], "mondo": ["0008056"], "omim": ["160900"], + "omim_gene": ["605377"], "orphanet": ["273"], "gnomad": ["DMPK"], "stripy": ["DMPK"], @@ -1929,6 +1956,7 @@ "medgen": ["336581"], "mondo": ["0009998"], "omim": ["268305"], + "omim_gene": ["608546"], "orphanet": ["3102"], "gnomad": ["EIF4A3"], "stripy": [], @@ -1996,6 +2024,7 @@ "medgen": [], "mondo": [], "omim": [], + "omim_gene": ["606265"], "orphanet": [], "gnomad": ["EP400"], "stripy": [], @@ -2062,7 +2091,8 @@ "malacard": [], "medgen": ["320250"], "mondo": ["0025193"], - "omim": ["615813"], + "omim": [], + "omim_gene": ["615813"], "orphanet": ["98897"], "gnomad": ["FAM193B"], "stripy": [], @@ -2130,6 +2160,7 @@ "medgen": ["1824051"], "mondo": ["0859340"], "omim": ["620174"], + "omim_gene": ["601515"], "orphanet": ["675216"], "gnomad": ["FGF14"], "stripy": ["FGF14"], @@ -2197,6 +2228,7 @@ "medgen": ["8912", "1644269", "333403"], "mondo": ["0010383", "0010706", "0010382"], "omim": ["300624", "300623", "311360"], + "omim_gene": ["309550"], "orphanet": ["908", "642691", "93256"], "gnomad": ["FMR1"], "stripy": ["FMR1"], @@ -2264,6 +2296,7 @@ "medgen": ["66312"], "mondo": ["0007201"], "omim": ["110100"], + "omim_gene": ["605597"], "orphanet": ["126"], "gnomad": ["FOXL2"], "stripy": ["FOXL2"], @@ -2341,6 +2374,7 @@ "medgen": ["383962"], "mondo": ["0100340"], "omim": ["229300"], + "omim_gene": ["606829"], "orphanet": ["95"], "gnomad": ["FXN"], "stripy": ["FXN"], @@ -2408,6 +2442,7 @@ "medgen": ["1718769"], "mondo": ["0030134"], "omim": ["618940"], + "omim_gene": ["605072"], "orphanet": [], "gnomad": ["GIPC1"], "stripy": ["GIPC1"], @@ -2475,6 +2510,7 @@ "medgen": ["987241"], "mondo": ["0600001"], "omim": ["618412"], + "omim_gene": ["138280"], "orphanet": ["557056"], "gnomad": ["GLS"], "stripy": ["GLS"], @@ -2546,7 +2582,8 @@ "malacard": ["FRN066"], "medgen": ["83266"], "mondo": [], - "omim": ["616180"], + "omim": [], + "omim_gene": ["616180"], "orphanet": [], "gnomad": [], "stripy": [], @@ -2614,6 +2651,7 @@ "medgen": ["331103"], "mondo": ["0007698"], "omim": ["140000"], + "omim_gene": ["142959"], "orphanet": ["2438"], "gnomad": ["HOXA13_1"], "stripy": ["HOXA13_1"], @@ -2681,6 +2719,7 @@ "medgen": ["331103"], "mondo": ["0007698"], "omim": ["140000"], + "omim_gene": ["142959"], "orphanet": ["2438"], "gnomad": ["HOXA13_2"], "stripy": ["HOXA13_2"], @@ -2748,6 +2787,7 @@ "medgen": ["331103"], "mondo": ["0007698"], "omim": ["140000"], + "omim_gene": ["142959"], "orphanet": ["2438"], "gnomad": ["HOXA13_3"], "stripy": ["HOXA13_3"], @@ -2815,6 +2855,7 @@ "medgen": ["1809573"], "mondo": ["0008513"], "omim": ["186000"], + "omim_gene": ["142989"], "orphanet": ["295195"], "gnomad": ["HOXD13"], "stripy": ["HOXD13"], @@ -2897,6 +2938,7 @@ "medgen": ["5654"], "mondo": ["0007739"], "omim": ["143100"], + "omim_gene": ["613004"], "orphanet": ["399"], "gnomad": ["HTT"], "stripy": ["HTT"], @@ -2964,6 +3006,7 @@ "medgen": ["341120"], "mondo": ["0011671"], "omim": ["606438"], + "omim_gene": ["605268"], "orphanet": ["98934"], "gnomad": ["JPH3"], "stripy": ["JPH3"], @@ -3031,6 +3074,7 @@ "medgen": ["1684682"], "mondo": ["0020793"], "omim": ["164310"], + "omim_gene": ["618299"], "orphanet": ["98897"], "gnomad": ["LRP12"], "stripy": ["LRP12"], @@ -3108,6 +3152,7 @@ "medgen": ["462210"], "mondo": ["0013322"], "omim": ["613608"], + "omim_gene": ["613297"], "orphanet": ["86814"], "gnomad": ["MARCHF6"], "stripy": ["MARCHF6"], @@ -3175,6 +3220,7 @@ "medgen": ["424853"], "mondo": ["0012360"], "omim": ["609893"], + "omim_gene": ["620898"], "orphanet": [], "gnomad": ["PRE-MIR7-2"], "stripy": [], @@ -3242,6 +3288,7 @@ "medgen": ["358137"], "mondo": ["0020726"], "omim": ["174000"], + "omim_gene": ["158340"], "orphanet": ["88949"], "gnomad": [], "stripy": [], @@ -3309,6 +3356,7 @@ "medgen": ["934642"], "mondo": ["0020781"], "omim": ["617186"], + "omim_gene": ["608862"], "orphanet": ["555407"], "gnomad": ["NAXE"], "stripy": [], @@ -3376,6 +3424,7 @@ "medgen": ["400169"], "mondo": ["0004976"], "omim": ["105400"], + "omim_gene": ["608145"], "orphanet": ["803"], "gnomad": ["NIPA1"], "stripy": ["NIPA1"], @@ -3453,6 +3502,7 @@ "medgen": ["483339"], "mondo": ["0013594"], "omim": ["614153"], + "omim_gene": ["614154"], "orphanet": ["276198"], "gnomad": ["NOP56"], "stripy": ["NOP56"], @@ -3520,6 +3570,7 @@ "medgen": ["355075"], "mondo": ["0011327"], "omim": ["603472", "619473"], + "omim_gene": ["618025"], "orphanet": ["2289"], "gnomad": ["NOTCH2NLC"], "stripy": ["NOTCH2NLC"], @@ -3587,6 +3638,7 @@ "medgen": ["1684701"], "mondo": ["0032843"], "omim": ["618637"], + "omim_gene": ["618639"], "orphanet": [], "gnomad": ["NUTM2B-AS1"], "stripy": ["NUTM2B-AS1"], @@ -3654,6 +3706,7 @@ "medgen": ["1054618"], "mondo": ["0958176"], "omim": ["164300"], + "omim_gene": ["602279"], "orphanet": ["270"], "gnomad": ["PABPN1"], "stripy": ["PABPN1"], @@ -3721,6 +3774,7 @@ "medgen": ["1794285"], "mondo": ["0800026"], "omim": ["209880"], + "omim_gene": ["603851"], "orphanet": ["661"], "gnomad": ["PHOX2B"], "stripy": ["PHOX2B"], @@ -3788,6 +3842,7 @@ "medgen": ["355637"], "mondo": ["0011155"], "omim": ["601846"], + "omim_gene": ["613247"], "orphanet": ["696063"], "gnomad": [], "stripy": [], @@ -3870,6 +3925,7 @@ "medgen": ["897191", "371919"], "mondo": ["0009783", "0024528"], "omim": ["258450", "157640"], + "omim_gene": ["174763"], "orphanet": ["520820"], "gnomad": [], "stripy": [], @@ -3937,6 +3993,7 @@ "medgen": ["347653"], "mondo": ["0011439"], "omim": ["604326"], + "omim_gene": ["604325"], "orphanet": ["98762"], "gnomad": ["PPP2R2B"], "stripy": ["PPP2R2B"], @@ -4004,6 +4061,7 @@ "medgen": ["894363"], "mondo": ["0014662"], "omim": ["616488"], + "omim_gene": ["616458"], "orphanet": ["478664"], "gnomad": ["PRDM12"], "stripy": ["PRDM12"], @@ -4081,6 +4139,7 @@ "medgen": ["155837"], "mondo": ["0007403", "0007656"], "omim": ["123400", "137440"], + "omim_gene": ["176640"], "orphanet": ["282166", "356"], "gnomad": ["PRNP"], "stripy": [], @@ -4158,6 +4217,7 @@ "medgen": [], "mondo": [], "omim": [], + "omim_gene": ["607642"], "orphanet": ["86814"], "gnomad": [], "stripy": [], @@ -4235,6 +4295,7 @@ "medgen": ["1648435"], "mondo": ["0054847"], "omim": ["618075"], + "omim_gene": ["609530"], "orphanet": ["86814"], "gnomad": ["RAPGEF2"], "stripy": ["RAPGEF2"], @@ -4312,6 +4373,7 @@ "medgen": ["482853"], "mondo": ["0044720"], "omim": ["614575", "608088"], + "omim_gene": ["102579"], "orphanet": ["504476", "139564"], "gnomad": ["RFC1"], "stripy": ["RFC1"], @@ -4379,6 +4441,7 @@ "medgen": ["1809981"], "mondo": ["0030712"], "omim": ["619790"], + "omim_gene": ["614092"], "orphanet": ["98897"], "gnomad": ["RILPL1"], "stripy": ["RILPL1"], @@ -4456,6 +4519,7 @@ "medgen": ["3486"], "mondo": ["0007340"], "omim": ["119600"], + "omim_gene": ["600211"], "orphanet": ["1452"], "gnomad": ["RUNX2"], "stripy": ["RUNX2"], @@ -4533,6 +4597,7 @@ "medgen": ["371424"], "mondo": ["0010985"], "omim": ["601068"], + "omim_gene": ["618073"], "orphanet": ["86814"], "gnomad": ["SAMD12"], "stripy": ["SAMD12"], @@ -4600,6 +4665,7 @@ "medgen": ["394771"], "mondo": ["0010252", "0800474"], "omim": ["300123", "312000"], + "omim_gene": ["313430"], "orphanet": ["67045"], "gnomad": ["SOX3"], "stripy": ["SOX3"], @@ -4677,6 +4743,7 @@ "medgen": ["375031"], "mondo": ["0011930"], "omim": ["607876"], + "omim_gene": ["616712"], "orphanet": ["86814"], "gnomad": ["STARD7"], "stripy": ["STARD7"], @@ -4744,6 +4811,7 @@ "medgen": ["326820"], "mondo": ["0010747"], "omim": ["314250"], + "omim_gene": ["313650"], "orphanet": ["53351"], "gnomad": [], "stripy": [], @@ -4810,7 +4878,8 @@ "malacard": [], "medgen": ["320250"], "mondo": ["0025193"], - "omim": ["612655"], + "omim": [], + "omim_gene": ["612655"], "orphanet": ["98897"], "gnomad": [], "stripy": [], @@ -4878,6 +4947,7 @@ "medgen": ["337637"], "mondo": ["0011781"], "omim": ["607136"], + "omim_gene": ["600075"], "orphanet": ["98759"], "gnomad": ["TBP"], "stripy": ["TBP"], @@ -4945,6 +5015,7 @@ "medgen": ["21498"], "mondo": ["0008542"], "omim": ["187500"], + "omim_gene": ["602054"], "orphanet": ["3303"], "gnomad": ["TBX1"], "stripy": ["TBX1"], @@ -5012,6 +5083,7 @@ "medgen": ["442479"], "mondo": ["0013203"], "omim": ["613267"], + "omim_gene": ["602272"], "orphanet": ["98974"], "gnomad": ["TCF4"], "stripy": ["TCF4"], @@ -5079,6 +5151,7 @@ "medgen": ["431598"], "mondo": ["0975800"], "omim": ["620947"], + "omim_gene": ["609119"], "orphanet": [], "gnomad": ["THAP11"], "stripy": [], @@ -5156,6 +5229,7 @@ "medgen": ["1648448"], "mondo": ["0054846"], "omim": ["618074"], + "omim_gene": ["610739"], "orphanet": ["86814"], "gnomad": ["TNRC6A"], "stripy": ["TNRC6A"], @@ -5223,6 +5297,7 @@ "medgen": [], "mondo": [], "omim": [], + "omim_gene": ["188350"], "orphanet": [], "gnomad": [], "stripy": [], @@ -5290,6 +5365,7 @@ "medgen": ["1786836"], "mondo": ["0030977"], "omim": ["619216"], + "omim_gene": ["611901"], "orphanet": ["314485"], "gnomad": ["VWA1"], "stripy": [], @@ -5372,6 +5448,7 @@ "medgen": ["862731"], "mondo": ["0014343"], "omim": ["615777"], + "omim_gene": ["608124"], "orphanet": ["1425"], "gnomad": ["XYLT1"], "stripy": ["XYLT1"], @@ -5449,6 +5526,7 @@ "medgen": ["767474"], "mondo": ["0014055"], "omim": ["615127"], + "omim_gene": ["613373"], "orphanet": ["86814"], "gnomad": ["YEATS2"], "stripy": ["YEATS2"], @@ -5516,6 +5594,7 @@ "medgen": ["199815"], "mondo": ["0010847"], "omim": ["600223"], + "omim_gene": ["104155"], "orphanet": ["98765"], "gnomad": ["ZFHX3"], "stripy": [], @@ -5583,6 +5662,7 @@ "medgen": ["355304"], "mondo": ["0012322"], "omim": ["609637"], + "omim_gene": ["603073"], "orphanet": ["2162"], "gnomad": ["ZIC2"], "stripy": ["ZIC2"], @@ -5650,6 +5730,7 @@ "medgen": ["419019"], "mondo": ["0010752"], "omim": ["314390"], + "omim_gene": ["300265"], "orphanet": [], "gnomad": ["ZIC3"], "stripy": ["ZIC3"], @@ -5716,7 +5797,8 @@ "malacard": ["ATS007"], "medgen": [], "mondo": ["0005258", "0005260"], - "omim": ["616181"], + "omim": [], + "omim_gene": ["616181"], "orphanet": [], "gnomad": ["ZNF713"], "stripy": [], diff --git a/data/STRchive-loci.schema.json b/data/STRchive-loci.schema.json index a9379349..1b94a862 100644 --- a/data/STRchive-loci.schema.json +++ b/data/STRchive-loci.schema.json @@ -604,7 +604,7 @@ "omim": { "section": "IDs", "title": "OMIM", - "description": "OMIM ID(s) for the disease", + "description": "OMIM phenotype ID(s) for the disease. Leave empty if OMIM has no phenotype entry; gene entries go in omim_gene", "examples": ["614575"], "uri-template": "https://omim.org/entry/{id}", "type": "array", @@ -614,6 +614,19 @@ "type": ["string"] } }, + "omim_gene": { + "section": "IDs", + "title": "OMIM Gene", + "description": "OMIM gene ID(s) for the gene containing the locus. Populated from HGNC by scripts/getOMIMgene.py", + "examples": ["601464"], + "uri-template": "https://omim.org/entry/{id}", + "type": "array", + "uniqueItems": true, + "items": { + "title": "", + "type": ["string"] + } + }, "orphanet": { "section": "IDs", "title": "Orphanet", @@ -827,6 +840,7 @@ "medgen", "mondo", "omim", + "omim_gene", "orphanet", "gnomad", "stripy", diff --git a/scripts/check-loci.py b/scripts/check-loci.py index a2945661..83c32c68 100644 --- a/scripts/check-loci.py +++ b/scripts/check-loci.py @@ -27,6 +27,7 @@ "interruption_gene_orientation", "inheritance", "omim", + "omim_gene", "stripy", "gnomad", "genereviews", diff --git a/scripts/getOMIMgene.py b/scripts/getOMIMgene.py new file mode 100644 index 00000000..320014ad --- /dev/null +++ b/scripts/getOMIMgene.py @@ -0,0 +1,98 @@ +#!/usr/bin/env python3 +""" +Add OMIM gene IDs to STRchive-loci.json. + +Looks up each locus's gene symbol in HGNC and fills omim_gene where it is empty. +Existing values are left unchanged. +""" +import argparse +import json +import sys +import time +from pathlib import Path + +import jsbeautifier +import requests + +REPO = Path(__file__).resolve().parent.parent +LOCI_PATH = REPO / "data" / "STRchive-loci.json" + +HGNC_URL = "https://rest.genenames.org/fetch/symbol/{symbol}" + +def write_loci(loci, loci_path): + """Write loci to path""" + options = jsbeautifier.default_options() + options.indent_size = 2 + options.brace_style = "expand" + with open(loci_path, "w") as fh: + fh.write(jsbeautifier.beautify(json.dumps(loci, ensure_ascii=False), options)) + fh.write("\n") + +def hgnc_omim(symbol): + """OMIM gene ID(s) for an approved HGNC gene symbol.""" + response = requests.get( + HGNC_URL.format(symbol=symbol), + headers={"Accept": "application/json"}, + timeout=30, + ) + response.raise_for_status() + docs = response.json()["response"]["docs"] + if not docs: + return None + return docs[0].get("omim_id", []) + +def with_omim_gene(locus): + """Return locus with an omim_gene key placed after omim (schema order).""" + if "omim_gene" in locus: + return locus + out = {} + for key, value in locus.items(): + out[key] = value + if key == "omim": + out["omim_gene"] = [] + out.setdefault("omim_gene", []) + return out + +def main(): + parser = argparse.ArgumentParser( + description=__doc__, formatter_class=argparse.RawDescriptionHelpFormatter + ) + parser.add_argument( + "--loci", + type=Path, + default=LOCI_PATH, + help="path to STRchive-loci.json (default: %(default)s)", + ) + args = parser.parse_args() + loci_path = args.loci.resolve() + if not loci_path.exists(): + sys.exit(f"ERROR: {loci_path} not found") + with open(loci_path) as fh: + loci = [with_omim_gene(locus) for locus in json.load(fh)] + + n_filled = 0 + cache = {} + for locus in loci: + if locus.get("omim_gene"): + continue + symbol = locus.get("gene") + if symbol not in cache: + cache[symbol] = hgnc_omim(symbol) + time.sleep(0.1) # HGNC asks for <10 requests per second + omim = cache[symbol] + if omim is None: + print(f"WARNING: {locus['id']}: {symbol} is not an approved HGNC symbol", file=sys.stderr) + elif not omim: + print(f"WARNING: {locus['id']}: no OMIM gene ID in HGNC for {symbol}", file=sys.stderr) + else: + locus["omim_gene"] = omim + n_filled += 1 + + print(f"Loci: {len(loci)}") + print(f" omim_gene filled: {n_filled}") + write_loci(loci, loci_path) + print(f"Wrote {loci_path}") + + +if __name__ == "__main__": + main() diff --git a/site/src/data/identifiers.ts b/site/src/data/identifiers.ts index 4def168a..fef31c72 100644 --- a/site/src/data/identifiers.ts +++ b/site/src/data/identifiers.ts @@ -56,6 +56,13 @@ export const getIdentifiers = (object: Record) => "Compendium focused on genotype-phenotype relationships in Mendelian disorders", info: "https://omim.org", }, + { + key: "omim_gene", + name: "OMIM Gene", + link: "https://omim.org/entry/$ID", + tooltip: "OMIM entry for the gene containing the locus", + info: "https://omim.org", + }, { key: "orphanet", name: "Orphanet", From c16dab2ce810f2500084b28f43ea40ac6303cf10 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 17:56:21 -0600 Subject: [PATCH 11/18] Align criTRia curations with STRchive loci - OPML1: curation Locus_ID OPML1_NUTM2B_AS1 -> OPML1_NUTM2B-AS1 so it links to its locus - ALS1_NIPA1: gene NIPA -> NIPA1 - SCA27B_FGF14: inheritance AR -> AD - SBMA_AR: inheritance AR -> XR - FRAXE_AFF2: inheritance XLR -> XR - Disease IDs HSAN-VIII -> "HSAN VIII" and EDM1-PSACH -> "EDM1, PSACH" Co-Authored-By: Claude Opus 5.5 --- ...ve-disease-loci.T2T-chm13.expansionhunter.json | 0 .../STRchive-disease-loci.T2T-chm13.strkit.bed | 0 .../STRchive-disease-loci.T2T-chm13.ucsc.bed | 0 .../STRchive-disease-loci.hg19.atarva.bed | 0 .../STRchive-disease-loci.hg19.longTR.bed | 0 .../STRchive-disease-loci.hg19.straglr.bed | 0 .../STRchive-disease-loci.hg19.stranger.json | 0 .../STRchive-disease-loci.hg19.strkit.bed | 0 data/catalogs/STRchive-disease-loci.hg19.ucsc.bed | 0 .../STRchive-disease-loci.hg38.atarva.bed | 0 .../STRchive-disease-loci.hg38.atarva.bed.gz | Bin .../STRchive-disease-loci.hg38.atarva.bed.gz.tbi | Bin ...TRchive-disease-loci.hg38.expansionhunter.json | 0 .../STRchive-disease-loci.hg38.general.bed | 0 .../STRchive-disease-loci.hg38.longTR.bed | 0 .../STRchive-disease-loci.hg38.straglr.bed | 0 .../STRchive-disease-loci.hg38.stranger.json | 0 .../STRchive-disease-loci.hg38.strkit.bed | 0 data/catalogs/STRchive-disease-loci.hg38.ucsc.bb | Bin data/catalogs/STRchive-disease-loci.hg38.ucsc.bed | 0 data/criTRia-curations.json | 14 +++++++------- 21 files changed, 7 insertions(+), 7 deletions(-) mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg19.atarva.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg19.longTR.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg19.straglr.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg19.stranger.json mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg19.strkit.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg19.ucsc.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.atarva.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.general.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.longTR.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.straglr.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.stranger.json mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.strkit.bed mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.ucsc.bb mode change 100644 => 100755 data/catalogs/STRchive-disease-loci.hg38.ucsc.bed diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg19.strkit.bed b/data/catalogs/STRchive-disease-loci.hg19.strkit.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json b/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.general.bed b/data/catalogs/STRchive-disease-loci.hg38.general.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.longTR.bed b/data/catalogs/STRchive-disease-loci.hg38.longTR.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.straglr.bed b/data/catalogs/STRchive-disease-loci.hg38.straglr.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.stranger.json b/data/catalogs/STRchive-disease-loci.hg38.stranger.json old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.strkit.bed b/data/catalogs/STRchive-disease-loci.hg38.strkit.bed old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bb b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bb old mode 100644 new mode 100755 diff --git a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed old mode 100644 new mode 100755 diff --git a/data/criTRia-curations.json b/data/criTRia-curations.json index 53f3a06f..c96d63b3 100644 --- a/data/criTRia-curations.json +++ b/data/criTRia-curations.json @@ -93,7 +93,7 @@ "Disease_ID": "FRAXE", "Gene": "AFF2", "Locus_ID": "FRAXE_AFF2", - "Inheritance": "XLR", + "Inheritance": "XR", "Curator": "Intellectual Disability and Autism GCEP", "Contributors": null, "Date": "08/11/2025", @@ -262,7 +262,7 @@ "Disease_ID": "SBMA", "Gene": "AR", "Locus_ID": "SBMA_AR", - "Inheritance": "AR", + "Inheritance": "XR", "Curator": "Amyotrophic Lateral Sclerosis Spectrum Disorders GCEP", "Contributors": null, "Date": "08/08/2023", @@ -1719,7 +1719,7 @@ "classification": "Definitive" }, { - "Disease_ID": "EDM1-PSACH", + "Disease_ID": "EDM1, PSACH", "Gene": "COMP", "Locus_ID": "EDM1-PSACH_COMP", "Inheritance": "AD", @@ -2394,7 +2394,7 @@ "Disease_ID": "SCA27B", "Gene": "FGF14", "Locus_ID": "SCA27B_FGF14", - "Inheritance": "AR", + "Inheritance": "AD", "Curator": "Laurel Hiatt", "Contributors": "Harriet Dashnow", "Date": "06/04/2025", @@ -3858,7 +3858,7 @@ }, { "Disease_ID": "ALS1", - "Gene": "NIPA", + "Gene": "NIPA1", "Locus_ID": "ALS1_NIPA1", "Inheritance": "AD", "Curator": "Harriet Dashnow", @@ -4129,7 +4129,7 @@ { "Disease_ID": "OPML1", "Gene": "NUTM2B-AS1", - "Locus_ID": "OPML1_NUTM2B_AS1", + "Locus_ID": "OPML1_NUTM2B-AS1", "Inheritance": "AD", "Curator": "Macayla Weiner", "Contributors": "Laurel Hiatt", @@ -4634,7 +4634,7 @@ "classification": "Moderate" }, { - "Disease_ID": "HSAN-VIII", + "Disease_ID": "HSAN VIII", "Gene": "PRDM12", "Locus_ID": "HSAN-VIII_PRDM12", "Inheritance": "AR", From 574662f79ddc3a8106078c3fbb6469a5a7262cb2 Mon Sep 17 00:00:00 2001 From: hdashnow <3794821+hdashnow@users.noreply.github.com> Date: Sat, 3 Oct 2026 00:05:11 +0000 Subject: [PATCH 12/18] Update data --- .../STRchive-disease-loci.T2T-chm13.TRGT.bed | 2 +- ...STRchive-disease-loci.T2T-chm13.atarva.bed | 2 +- ...chive-disease-loci.T2T-chm13.atarva.bed.gz | Bin 1880 -> 1881 bytes ...e-disease-loci.T2T-chm13.atarva.bed.gz.tbi | Bin 4481 -> 4479 bytes ...isease-loci.T2T-chm13.expansionhunter.json | 2 +- ...TRchive-disease-loci.T2T-chm13.general.bed | 2 +- ...STRchive-disease-loci.T2T-chm13.longTR.bed | 2 +- ...TRchive-disease-loci.T2T-chm13.straglr.bed | 2 +- ...chive-disease-loci.T2T-chm13.stranger.json | 4 ++-- ...STRchive-disease-loci.T2T-chm13.strkit.bed | 2 +- .../STRchive-disease-loci.T2T-chm13.ucsc.bb | Bin 45166 -> 45172 bytes .../STRchive-disease-loci.T2T-chm13.ucsc.bed | 2 +- .../STRchive-disease-loci.hg19.TRGT.bed | 2 +- .../STRchive-disease-loci.hg19.atarva.bed | 2 +- .../STRchive-disease-loci.hg19.atarva.bed.gz | Bin 1900 -> 1900 bytes ...Rchive-disease-loci.hg19.atarva.bed.gz.tbi | Bin 4469 -> 4466 bytes ...ive-disease-loci.hg19.expansionhunter.json | 2 +- .../STRchive-disease-loci.hg19.general.bed | 2 +- .../STRchive-disease-loci.hg19.longTR.bed | 2 +- .../STRchive-disease-loci.hg19.straglr.bed | 2 +- .../STRchive-disease-loci.hg19.stranger.json | 4 ++-- .../STRchive-disease-loci.hg19.strkit.bed | 2 +- .../STRchive-disease-loci.hg19.ucsc.bb | Bin 45055 -> 45062 bytes .../STRchive-disease-loci.hg19.ucsc.bed | 2 +- .../STRchive-disease-loci.hg38.TRGT.bed | 2 +- .../STRchive-disease-loci.hg38.atarva.bed | 2 +- .../STRchive-disease-loci.hg38.atarva.bed.gz | Bin 1884 -> 1884 bytes ...Rchive-disease-loci.hg38.atarva.bed.gz.tbi | Bin 4457 -> 4458 bytes ...ive-disease-loci.hg38.expansionhunter.json | 2 +- .../STRchive-disease-loci.hg38.general.bed | 2 +- .../STRchive-disease-loci.hg38.longTR.bed | 2 +- .../STRchive-disease-loci.hg38.straglr.bed | 2 +- .../STRchive-disease-loci.hg38.stranger.json | 4 ++-- .../STRchive-disease-loci.hg38.strkit.bed | 2 +- .../STRchive-disease-loci.hg38.ucsc.bb | Bin 45244 -> 45249 bytes .../STRchive-disease-loci.hg38.ucsc.bed | 2 +- data/criTRia-curations.tsv | 8 ++++---- data/plots/path-size.json | 12 ++++++------ data/ref-alleles/ref-alleles.T2T-chm13.txt | 2 +- data/ref-alleles/ref-alleles.hg19.txt | 2 +- data/ref-alleles/ref-alleles.hg38.txt | 2 +- 41 files changed, 43 insertions(+), 43 deletions(-) diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed index 98b77db6..957a8d96 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed @@ -6,7 +6,7 @@ chr1 154328121 154330802 ID=ADTKD_MUC1;MOTIFS=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGG chr1 155728131 155728159 ID=NME_NAXE;MOTIFS=CCGGG,GGGCC;STRUC= chr2 96703674 96703732 ID=FAME2_STARD7;MOTIFS=AAATG,AAAAT,TGAAA;STRUC= chr2 100563685 100563738 ID=FRA2A_AFF3;MOTIFS=CCG;STRUC= -chr2 176581179 176581224 ID=SD5_HOXD13;MOTIFS=GCN;STRUC= +chr2 176581179 176581224 ID=SPD1_HOXD13;MOTIFS=GCN;STRUC= chr2 191369982 191370024 ID=GDPAG_GLS;MOTIFS=CAG;STRUC= chr3 63956302 63956345 ID=SCA7_ATXN7;MOTIFS=CAG,CCG;STRUC= chr3 131917482 131917635 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed index 3dced72a..a5f610d7 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed @@ -7,7 +7,7 @@ chr1 154328121 154330802 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC chr1 155728131 155728159 CCGGG 5 NME_NAXE chr2 96703674 96703677 AAATG 5 FAME2_STARD7 chr2 100563685 100563738 CCG 3 FRA2A_AFF3 -chr2 176581179 176581224 GCN 3 SD5_HOXD13 +chr2 176581179 176581224 GCN 3 SPD1_HOXD13 chr2 191369982 191370024 CAG 3 GDPAG_GLS chr3 63956302 63956333 CAG 3 SCA7_ATXN7 chr3 63956333 63956345 CCG 3 SCA7_ATXN7_flank diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz index 7543c9151db2cb160d6629772d8f47a875103405..3c12ee20029c32632a33bf74966d296869ef1171 100644 GIT binary patch delta 1838 zcmV+}2hsT04%rSOABzYC000000RIL6LPG)oJO_oBP0!o75rEIL|0MuthUAeVDt`!0 z6dKna;vl4$QmkKq3eNL#m-6lJ0e}0Wx<*JFFKP#d6hg>gV2gpJOyMw0ugO}Y^#Cgn zV*-ZTI?bkpL!7vasGUJ?y%{9zpw`Z?TrN{tZaJQ5xyE4|&E$|ev2u!P!6~H}Q%EVN z5JQY9*I(*a`^5T33MoF-6zjh^Wq+^;Vai{oGJlP@S7L-5@{^43m4Ja|K9(gsj?Gly zl=Vi?4bXerZ|i);vV6@m9X^Gv7mR@DiLAA>legoA&xftV!?k$?)@$*K`%@#tP@U<% zUPB3a!J!$YtyA7~K-_CT-2+l6(`BW@P!Z9Hal(VVRuFTQw-~5|{8(sLiGK}~scIvu z_}Qyz*5!V=uGhT@$b^V&aga89YquE6an(vSv-X88(i1d8%%OX()$eXw`SV}D|NEaG zUeG(pTZ5l34Apz|mW}J6m4*}-U^uTwQ+`|`4G$Hvh|zwKc!IFEmgG=Q>4dt;8c+<8 zcCLd#KMK9A^HkPwSjRkQaDSGSszQS{UVBTqwY0Bw1EjQZ2Gs!GXFpswEX!pb`^*4S zt*U>C@MeZr2oC7_zfWTCp2o1X9i!G{p0gxXhQke4^bI<(yWugM$<^ zFvRtEE9>o=-lo93qz;I++`|Qj z>QHH^%ejH!x~^jlY=1S{#h4psAO-ihZsmA6>Cmfj;HYlj`tZs?szZ^%LR`PjC4Zl{ zp&2926Y~J)#z>rwapIEWsc#1lT6;}M^(m|gY77lA)TZZ@YSaxW*GK(1hZs_5aW}`9 zYu&ZIDd&(Gra%HTcB_pfXCR@Uof*?(Jt%*@Dkz;mFt7;K3l zE&;=?YD;8|8Q|&d7^0Fc>xlUt(0M}3YJfHnQ(e5rX~s|M7UH?Y+q~|B;fxpI9gN*W z^o(Vi*DqBg@KzLC(K`s#(=v^jrn2R5pQO8}l(B4`8Pv|fIHEa)5>6)`rdZ<;#SbFd z!`-${SkAY{gnzs0k*)WxlPL9E=xJI*D(Sj4Q2|-U=zMz;t2Vnifo*%omgTk@`=(Z< zJ==-*v-*k)q(BQht89NVLtVJxc`WDWNnKk;0`c=y*88&lTn2M{iZZ>7{Hp@=vw-$0 zf+l2AMi1~^lipl73v8`RF`u-7gn_eCv0!fdS59fZ`FtMe(+dV`Hsg*}^<^+XIPlT3POZrpAj{TVdgprcz6p=6cUt3HQgF<=n75?{j{<9FO?YSUE@az;7VB?&6l>&QqD@>3>bC z|8+138E{u#Bm4ksycpEdfsERh`C$$v+=t|y6ExhR9?&7R;AP=4ttE#Ojv-;=#ER%a z?s;AM7Ggf$uaA0V;$3#GZf)L4yV2vv^)i+1_Si*jQEcsUC$Y~({@BWCzT?vqYtXAf cHI;l#$+6}+^xJ;{asMmJnGgT~ACo-?8vxg=!2kdN delta 1838 zcmV+}2hsT14%iMNABzYC000000RIL6LPG)oI|qfAP0!o75rEI!{}O;R!{L!4Du1Ay zXkgbK;#5d6rC7fdXmy^KyOeK#5AfR`)n!4$Ui1#6QV1a{R$B}tWeSI3dV|)oF$1iq z7?UD(Tc?>zIK+v%2*xpZ>v@onQ?+(d%jGha<(A_amunn08$t)ziL}#L3r;D;m_kZ9 zg&1N?x&BhW+9%dOQb_Tsrda>YDSs;qDopvyROYV{_DWdL0X>O*uSBt0=3`mH{8|$>^4gh=Yr+WYlWxA|*7%Bj;uoD{OjaD&Nd5Zx{$d3hg6@Q5dxvGt< zrf09F*_8X`x?cAt03iU7g+Ye*)^0JB<7%{SX6*}Ez$X||F^BHCR=>M#<#VIA{elz+3Nbrl-4@!DHTt)+dfvqEjyG3Wub&wjXWP?pO&_8BX} zS|j5CaVlno>i1K=PM^M(bi1bD!jPRMG@9H17L{_&%BXl=5|#OKmruC6qMb7ucW^4j ztVqT6cq{Aen%<^>Us4BvTJry~0R}MsZ`sYW3dD$b?Hf3)s~79~K7age!t(fj%`i+f z&TI1o(kka1gJN|G^U;>P+@lRc7DQ*P9UygMhuk)8od+m~V_5crg)BKs0|d=$(K3{L z4l6uWXEn3N0oIR5w#8t|kJI@bj0Kuz%HP7h`Um6>4>l>sF4JlL@^VrySPpTOVGtN_8l*vMR1$=aRqA z+t8TBc_bR(+!%?|F-}x+JoWA1l`-BRV0{W1R5gZ%7;4jVN;T?+l?-js7lDKss zLtFxcT{RZbG7s?hb_`)jmvzK^ufTZ(OL~A|6;oZj$7zO7>lWg<#M`{?gW=eV&<3ii)47vfh{V=Q4=eQ#AK7@~;Xo&jQ-3 zpbP?`W;4J;ZSlwoYLRH(s_ZQ;6t)qi7n^X*jf;Q>Plqv4`S*&@~ zHANltAsCiZn88zXYhXnU0t1|(cQYR%^r&TPpR|VFIjzy*Tm5}qch4}g81Fi?>p+{O z7^iaox;*eT4ff?Uu;9l2d&;A30Z(k$4QfYo*lU-P`=SBxP4$2So~!v??Iv4Y^Lagh{3}nFP<|{Y=@Hv0&@5n0&5b(MeS z(ypcv4Qk9%picKGl+$B*&6a-&9W2y4VSnpfce@1!owID+PJWMA=PfLszFjVtvfih8 zZ!Z`|$JCZ~rB-f={gYY()Dn%ANfO*ltn}1)hZ*(g1DkUKosYK-T**Kg^+o`;feI0!$t10Uc5cURFJ(wd8PuF(kxJtcV%p zp0}lMA?D-#`lvT1+GXeJ)~20|8$EtpFH_lWk6knt#MUl%68l`_kFA{MJ3KwH3|ufY8qr9J{^vqUNP@?aOt`2#HJw=6 zC!>r_)0gUtxdiIQfco_IdY7}c{YA{lQUS49`CXX6hb5UA(7w||S)>&UOY>X)KB`)ls?TCBsCfvX+k0m#>F z)D;U){LkfM7;OJMq?fklKH) zM-U^G+E)6R&w1%mxyAlHw+VwOXOdz^s7a|@UrTl6dy?o+W~?K>pVuayH-PF8IOa&O zfV#7LajuhEpOZLnB|T_ra<#TmnAlp7+RuAj)*>9SROJXXNE_KTs+AVs`Ep~`hW2r} z{wS2&71%~=o;6*M8xg{)rHWG&a(k#W?WB-g(DpRaTeK1*?TM6yjUHAhtqR%*+cdB? z!wI&H&E{J5ObP)-mni};1%SGGwa;PKGmPf|%Q-FzR9Qm#=tB^=%@Jwz8pG2DADaXe zJ#{fI;eh+!DwqBb!oH)G_1CV)jT;YqZN_%B&8hh&aG8O1Yah<&bp%(y{EXa#&?TLH zb{WYUYN=il2bg{grl(iu$$y98$IUi9YwDK`(4u{ea?GCmMkO+{D7>8Z)nEL8a3Ui$w6I zo1>*%e4`A^W>54^Msh{IB~SN5;W{L!1F@N`o`mg2={_Od@DQ(xK1iD@+8ZT^sfJbU zHv^fu;G*qI(#-H>FeF83_u$M(8($YIiE$0g z#^|U+uUO|T0@(Mv0&-t*^1 zJP5iCw{ZMV2-TpM(pSO=Jo|@<*TXqnLzKD!`1GH%apds`wgQ>lCIydZXk@`;E#>Ul< z8r_Nh&f)LyM4)TFzq7D5RWi_Ty1`G=#tgBWe1J(@;1T{~ti^u%Q3| delta 1447 zcmY*YdpMM76rUM#ZKko!Zl$IMpV}_d)ooK_T*64COeve8TyiO4XH;TxN%paJH6Njx zhE?ce7|JC>(_-^jW-Ojju0yEyW6Z-Wb{NwR+oSe*-apQH-*bMybAIQ%AC2QpcuiVN zFQjyU=$2@U)f&osb}Px3Fr>pGClmulw#K}agP8bX#8piloYM!RMxrTwURZ6c$AwvK| z?Olx4aqGmt>4jsJWiO&byEdy)QW*}*NQ$F)P@kvLRXcHGH$ej=jxv3J*7&Woran}~ zIul)aEh0l!9OUzUn>JA(ie8tzaWhhQ#rRAgB@2&`eZ0=UTAQ2v-`n) zNE~RWlf^uTl=c(d>}_$YhU6D1O!9GOG6H3mtm*MP>I$$cH>;j27?VbN5-WuN861B(ZbL%WXVJUH5p)IXv1JN;*O#e=I)@VHkXc1qi zxbujg5#3eVKJe&ljj82d+bEG|g$G#veY!1`5hg7{j}t^?p<^PT|B*XZ=fbbLEw={q zka%V!UAi>~-_6%<7H)0`9+`z5bP zk_XGKLf;Z>bAt~z2CSKK8W9~~OEBZ|lOy8+Y$j)8tIx>(!qNI?<70J`dt@1kxgfa@ zOHU13EL~@knO?Lk9##*HIkw&2CE-s*qHS0pRlXB6GS~`w=-FtR^!#J96mwt{A#E)` zW`|sVWLW-_h0^qK_s`_>{Vz?6&L!Jr`JzMa{yI97l$0*BphdZhWd+WI%}g)?wZ-a2 zqy!p?A&On8(gG+>1wTG`34-^&4y>2`a`x0f90b$7TOrO9NP3!BEb)V2<+Vi?z-iq8 z4(l0exkdvD-$}3>Nzk^8L2eGP7+tD`*oly~mFqSj5Dpz%DpLarc-2v;tScJc)x0Zg zLg~o*yRVQANzuZQp&F>mOD(v$`Lv+lv)P*qjeAkMs-W)JcO)_Ijqn1MJ!igaKB@$2 z&PzVRsiM+*>TNy^TqVj;XBuhKFK%c=1y(wC$&n@14Y(Qh&HMl_}W3yAPZqaWpKEsn11M~VsUpU zgvp0Q`OvA>@XRg=+&B(RG@S zwpH9)dIw;Hw2zyH^1~%}1X-NWt z;YLJCd%4E~{BXC1=k6O==1{Dh?reyEo`51)nW17gz9ekdvPA-3y}5eV2}8OGSj;M{ z>fxo$1ATJ3g=P=)yG@FmLrvCaqter36$@+-5^Pt)r-TA(bvD^%!ua(k-dt zMn)RUD27g*q%QirF4|ofa)&=p%kOm+pBF5Yy)qW$K=6lLN4mvnD!vrz);9lUQS=Tv zNGhYHlIS(id|%)5!Q%3o3qhq&^GxX7|9vLKL~Hmu3d^{u3qjgRE^Cz#!fULYpu_=-E*aS~?y=U*Ley;pGr|b2Wr^P=?U& zCqrnH8Iu#$r)@T1yw6^5>v!0Ip>=nO!Oeu^PaQ53bC#D18Aft)di)9TW#4u}B`^7j zTIk~@CTsNvCTr%jN*jb*> z#YYe9t<6GA6a@Fd4>ss_tysb3=aM z2S@3Z)n437UDj=Hi#gF|FTr`&>7Gfc-cB*rnrXXQx_RTJcyD;DmW*PAggZZw@_Txo8ANAE$Z@AmKBpqjcxduF zAZb6DPgR~VezG2r?4IlgBqvYK1Cm!J_W{Y;$?Jfm*W`0Ra{uIaK+<6{pPD@5jmdgI z^5|qgAUS7p9+1?Y+y^9oPhJNk?@m4kB)3d{2PBtF=2HimtOq1lZT3^wmS&1~njA1g ziP3)ZJg4b0Ow#dS-u%r`@x?Mso2x-Qu4rgVieTBCsD4FsbAh@P)8?0xQ&|{ICi~A& S=K2gxQI1IREU!OxwgUj2I0L@` delta 1234 zcmezJfa%=>rU?>^o)abYgG_B1z#!5ILYpu_=&4Z=1h;aFteikw}Rr6wPJZWW1i1T#0O{X1RQEWPrAbyih@ zWtCLPcg`BA@cBp03-(1=B!x`UuQ@#ZU)|c=$ZNlEAAfOLB`rK%#XCJms*<5mSRjDk z^2+QtUC#v^)RTQKN;D=OJ!8(i`N$szLuawZ8Tv~n#W=?0Oldp4?ObSV{YjawsUb;M zw@hdVS^qjK@h029pL=9w_vN^MoFX`FqeWSjiQ9>#d|&S_tnA~zAR&Bz!|y-|wOW}L zt5>c|TZ5FYOFQeO9Dd*1lBbwI%W8T|Hks=BpCWbcKS zhhN8KPIAjDt1A|N==VY*p?{a%vA7@u6DKu$r^7m&>wgPel3bb_`XOffs=xj>-cA2@ z(J@o~qOSL*Cq{P}nciGb_~3cprlpQ?m+y&5c2~^B=QX+HZmE3PWzHn_>`zRW*8k>T zY+mej-!`XmaY-?HPA*XKt`A{^gg8Ht@_Txo8ANAE$Z^MWLBwOB@&Z7v^D{jL5G~ud ziE|G(M7|a(F9_s5m6*!_qGxo?<+9|3$SXkQg@9a>!jlXjINZCJI!U&?DK3c(X z4rCAztc2F)5Ixb)gJGRKME(PWVgMzXmdP$)`cKzWrg;hwiRVxUfTH|=tT7{qKBjw! zsa1(V4Xi>QssNN`!X7m-f#_-=y#!h;EZv-_eoJ)X2G-5iwl1uUk&_#ol({USWsU+X zSax%Px(L(e*-;Bvm_*|zH##XX&fJ_3Uo6A4wi?9a422ds5t|!lycgg6esU@c6R?;8 MDSW%Ra>j3Q0A%7V)Bpeg diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed index bfae7b82..52eac247 100755 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed @@ -6,7 +6,7 @@ chr1 154328121 154330802 ADTKD_MUC1 0 - 154328121 154330802 0,128,0 MUC1 GGCTNNG chr1 155728131 155728159 NME_NAXE 0 + 155728131 155728159 230,145,0 NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy Limited chr2 96703674 96703732 FAME2_STARD7 0 - 96703674 96703732 64,160,0 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2 Strong chr2 100563685 100563738 FRA2A_AFF3 0 - 100563685 100563738 0,128,0 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A Definitive -chr2 176581179 176581224 SD5_HOXD13 0 + 176581179 176581224 0,128,0 HOXD13 GCN GCN 22 AD Syndactyly Definitive +chr2 176581179 176581224 SPD1_HOXD13 0 + 176581179 176581224 0,128,0 HOXD13 GCN GCN 22 AD Synpolydactyly 1 Definitive chr2 191369982 191370024 GDPAG_GLS 0 + 191369982 191370024 0,128,0 GLS CAG CAG 680 AR Glutaminase deficiency Definitive chr3 63956302 63956333 SCA7_ATXN7 0 + 63956302 63956333 0,128,0 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7 Definitive chr3 131917482 131917557 DM2_CNBP 0 - 131917482 131917557 0,128,0 CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 Definitive diff --git a/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed b/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed index e5a9d62b..5967f183 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed @@ -6,7 +6,7 @@ chr1 155160981 155162030 ID=ADTKD_MUC1;MOTIFS=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGG chr1 156561557 156561575 ID=NME_NAXE;MOTIFS=CCGGG,GGGCC;STRUC= chr2 96862804 96862862 ID=FAME2_STARD7;MOTIFS=AAATG,AAAAT,TGAAA;STRUC= chr2 100721260 100721286 ID=FRA2A_AFF3;MOTIFS=CCG;STRUC= -chr2 176957786 176957831 ID=SD5_HOXD13;MOTIFS=GCN;STRUC= +chr2 176957786 176957831 ID=SPD1_HOXD13;MOTIFS=GCN;STRUC= chr2 191745598 191745646 ID=GDPAG_GLS;MOTIFS=CAG;STRUC= chr3 63898360 63898403 ID=SCA7_ATXN7;MOTIFS=CAG,CCG;STRUC= chr3 128891419 128891577 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed index 23ebe083..5ddc8d9b 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed @@ -7,7 +7,7 @@ chr1 155160981 155162030 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC chr1 156561557 156561575 CCGGG 5 NME_NAXE chr2 96862804 96862807 AAATG 5 FAME2_STARD7 chr2 100721260 100721286 CCG 3 FRA2A_AFF3 -chr2 176957786 176957831 GCN 3 SD5_HOXD13 +chr2 176957786 176957831 GCN 3 SPD1_HOXD13 chr2 191745598 191745646 CAG 3 GDPAG_GLS chr3 63898360 63898391 CAG 3 SCA7_ATXN7 chr3 63898391 63898403 CCG 3 SCA7_ATXN7_flank diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz index fa7e7763526e4971d7840841ff389dfc63c20ffe..000752c7c5a6c277f1d948fcc6313e0572b8178b 100644 GIT binary patch delta 914 zcmV;D18w~54(txF&I5mSz}1=>2L(6&-Dl!Y6f2XlI!)um@75Pu!=x-IKp>(E@w za^luH($6Z;&kE|JSQf0eCBm3=XJ&$_jIaHlwp4pqsf^D%&L!Xx{o=X z9@sT@f=o^tusgDx^E&6aFJJK7MQza|v2MUhL)kVxaY9v(2&^Y1Lpc>(>0|?sugD}- zly|Re@B(E%o?)qbukm9*a?YbJ>%5WorQQiNl#LLV)B1zx57BTH!<+cmdW+Oa1Y!XC zxy;U5?JRckO2dCLmB@cu&wC#4j~jKSlmJbs3!@Ee{!aAMD`Z5Mkv9TrZX+S?7d7OXeu*J)0yR0o4M_zSedW(ff zd0ki9T1QNc77lfhD;cJ@Xqd+^qvz_{5?RTKat$1tcQc(Lwyh+HdQ+ zdD^g78eNAHi0drHIOOefdC+Sb?8~WO_(N0;$C0qvNkL&gN=4!1wIQ294O*NW3IP(*=nZ|fy$a4cO1AnCI67u(Dloqia zpfXm~yI3Ql_ah7QZCjDLik`)z!6yl%awF?&1@j)}q1hftjIegpz-SGzUWmZLn1-5w zM*p8b|B&uW$vV;52BZiAAdK4(^7vR@v*lkx15$tGT3BDMxy?dmW32boNEEqa8}4EG z_A2jCk3Em`cC@a=I4ZN*h=kv!tTXR(u48kT>l1pd={-t%~W+^Cz5H7kYcNk7I&oxhz!+N-UBl~}8|mFC!qmmyzL zdNZtQr9bvnGhRK^z@Cj#-ZwzSB{`@kNDRx@u;*=T@j`<}(c+!2;FR|LRbssCdA-~p zE%(xZR*_|~e2}Og-bL~j*6BRfmob2fjV)$=j`I$~MJ)?xnZ#M$z#H?{ep}bg z(}um$=sJ`*TxTi9A#b0{gI?2MUrq(XM>hAAd)uO%DDQP6L}gx^1tq7ps0B!feaT}h zu)#i8mvMh8;W8k9T(8$RS8LtDsh_!Ts?prRnV+c5G{zf4o*Qr(_#;!7kiRdZw218h zm9eT`#TpU4pIDf0+ltgx^ei3?K1m>z3t3+)nD;Ob&GtZIgtemvMr(-mJ_HuVG}Qbv z`v3g-hjd>`(uvMCAVm-WVcdq0$H(%TE&mc4kSc$-!uoQ}Z5A>cW4)(FqR1WFa1YDJ z*X#9~*KL@O{vsQ%ttl(3kRa)LDAmtY6QG)COzqZ}>bo$(d>_8K9MAPG^#D>zd8Ji{ z5>AgZ^)cmByoGkEK7fp3EC*x*M}0QeE$umMk2gzfw;Uc3?0h|+@ue}cA}hLq5J5^c z!<~PJJj}zJRQ_wg3KHOXld=aS~oFaHJww-j(%oRdulA3Gn=`Tzg` diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz.tbi b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz.tbi index 57c12f9598ca4d4545fed8d70e7d6391552a64b0..767084f1e8262996b532d7839435ff52f8441e3c 100644 GIT binary patch delta 1700 zcmZWpe>l^59N%arS$-r%v88cb<_M|tV^6izWR>*Ak=Ar7hH@S9qgLlqccN$eKIm9R zL-`J~M9Qzaay`P_XvAhpq8lS)b7FJj>C!#-JfA;4pZD{AzuxcH>-~Oz6jpMp%BMQC z0JyB*$$>yIM1J4}nXWBl@0|{@eR*53e_Lk3q3x-B#Kv9QVqsZZPAe_Ve>w9{z6{*$ScscDC>4|e#r6vL^JIIb`- zv_JXP`^Z`6QIW=V`G7H6>uF;H6asUirUCahE1T4LN0!|o9}gbx`R$-Hcc#M~$4wS; zmCs*#-ITJnki7WK0UV8mc3%>%0cvWtTS6N`$9gM|tDH5adA`#Z2|gujp^eP7y#bk2 zX7B0h#D@d&+=D53l8qzvZ&NC8k8-IVvz@2xhC6z9a<~_TBa?SI*8js8>vAi6aC!=K zf}4OAx>+)e#gN6EN zn%V$KRaF%qR2EmW#y#@4sj9k^bM=Y}S@ErfzJ+|3#D^hDovWPd%lS3zABNuf&pSb~ zV@VU*2TY49t_wZy7;~?uyEE`;QX0N5<>vS_H&+!tS0OeNYw!YWyJ+5rb3u-GcUU&NSl_8>V{sl-!*?|Fi9xLWo$pwqP zZlf?+8!uuPW&M>mGigPWXB>)rrPmF$7>KP`s$ysMXBs!ExKDyj<1b>oLRai(jLUXbzJ4FP@sc^5?&~So(BOVA-I#O z_)wtL>zt?X5Q$vZ&r9naa0w7n7Sx~go~`rR2U4^)BTqHL=vCOLrI9y4q)wZRmovz7roB`o>1fKbiq? z<~>n~O*B_Px8Cd!M&jDtyV ze8vukr7}n;l=fl5Z7>uSwIZ5PytEFHf5T+`JknB^)>RHEO>I^mAH*DZt?OHm?07l7 zpqPEAas@*C*t)O)Q+U2{n0SDX|DENpsIy=G2sG4(WDXFkCl}xpLfyN83uV+}(K%i7 zrGKgLJ!54L%pvKy?co|x*C5c(Ck+hg0u#*4+1Q#?*Kx8elb716tnR zJU5Z!pQG`%MJD!p)_$W)S*l*N+Q>S}Dhip++Y@w&yTQNC@qw|kf1aZ;`S@|H?kUDo z{i7v6g;bN*YINMRbG9^p-@g^Me04E!ltdDGKvG9YT3Z^yBYOk4Xpv9_2l{9MD4Mw3 zX4O_pe0G(J6G6}03&^@}*wY1T5RK9X4nfmR%a!sAe0B`drrdt96i-{Ytk2z{+Rx*a-QcW0#-SWR9ku1wH#w=65kkZDXZDw#{QNn1|F8QnZPD7aJ z^dn#St40(}%1={@F-`I}h^XN+tuamGZ+6C}+I#M~=RWVb_qosW-uK=aQ>kgqV@-Mp z5*~E3_9SCa!x6S^rDwW$W^>6z4NSn`^rr@xDC~x;6M1%P&%d#g z$4K5T3SG;O!NeC?ne_+rwh$ON!Y%50vo{ona1+xo`$=hWd6Hg}jr`DfQ=x0@iOL5e zk??Wb9VX}Y11r_y&mGkH&WO&PhP_+lG5!7a`;YWmruN0iapJ1TG?v^+lB{Ut&)f@I zq|p7~jEbd(?lH-J8hcI|3F;{~A~41d9`#$MlKYpO-4v|QQ4-VRe7+vAa#Gy%Lg9{- z?r|MXl%wH~HnPw#NmeYsc(f#`#HJGniqG{Pn%mYowZr9isi1mp=VlUhMdAtr19yLR zlOoUMC1{7lfE!kyr~ih82kd;+$(U7LE(Bb}HVrRha!uXZ{$aJ2RrTpDFMv#ApHbf_ zT5DwR6&@+GwZp=Q5TSQ=ta1DyOA+QOATbIKd3+<4E0w!{fpL?th1}T(!X>b9+$+B_ z#-fkkI z%*{>mRp}eU4iMs!1hXi&oT8})_UyWXiz9a(vDaJ{pG7Hdrv^>yR24T4Y@PR?Sf=gC z_WDJOfoph*wG|fjEoVf2iSry(cLckrh(Q0IjC+|L!^&tbj zv9Fd`vkkX>*fDcZ&5P!tJL`V%6b-o=>1?wjxw|89G4@Q4>T3Z)M_!lGEQorKNf$h?sw7!;sU&GVLLfYOSa$Z+)5fdo!Y4GUMhs&{JepJOPhI6{ zc?$8md81HF#5wSijvbz`bh}v8aN|;P4uH=E5>j7Mc;dSNd)h%pL<<(!E+y39h363f zD^KkI`La2ao=OX5sD=-#FwFhk%NdH$(KF>=si=Oh4Yl3UcYNsaTDQg+ll_yuCeo52 z>Clr6h9(@dQEqbpw;;9D!(^UH8|(ap!&G+PE20z+iJYu^XCBZg(5uT(;$>)Q7Zn;O zTg^Q8CS?yE4;1v%N!d$B0|iU68RAOKapy}24F9)9DP0a@cY@27b@-yu>SWJ1;65}> zqqR)|ILr%+jLqn}c7shPW3o3^9!h5}xJ555;Ad4>wXR?L_$$R$T^C9OP z$T^0xZ>oR{Oq3QulMs}qtSIp$^(ZH&J^w9DLD@GpP6i}%=ghx-9skX_K}|{LRZniS z)`QODFVO>mQ|&5ct`tK>M_vCGeMtuX;V-77-Cp zn1Q_BLe6A-fXAPO<=?!S1{|=-R%T->UC!3U$%zBdi$qFbb_G;*4Z7!2MTRROQ3?Re zqwr991r$~eIrmnRE6XWN&dy4^NlpkLfRE(%a;zP1ybx0_Cx@iv*~~3m%%^mWiz^{Y z!-0rboI*%+^llrCBMk)pMq$}sKRl%+E(e|`DL+~qU8`-YDp_0&aCjr`sYBwebjpnv9LKa1_$%b$kf(BOj7k_Qx;Lz>{dJ?I$GF{JN&@ ryV3o1(fxwa5dd&2yLr!g8xw)RX0O&jsG33(;qkK?!Wf~x3{}IwxLP+t diff --git a/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json b/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json index 457d1188..9e05785d 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json +++ b/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json @@ -48,7 +48,7 @@ "VariantType": "Repeat" }, { - "LocusId": "SD5_HOXD13", + "LocusId": "SPD1_HOXD13", "LocusStructure": "(GCN)*", "ReferenceRegion": "chr2:176957786-176957831", "VariantType": "Repeat" diff --git a/data/catalogs/STRchive-disease-loci.hg19.general.bed b/data/catalogs/STRchive-disease-loci.hg19.general.bed index f601ed7b..0b8d83c7 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.general.bed @@ -7,7 +7,7 @@ chr1 155160981 155162030 ADTKD_MUC1 MUC1 GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTC chr1 156561557 156561575 NME_NAXE NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy chr2 96862804 96862862 FAME2_STARD7 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2 chr2 100721260 100721286 FRA2A_AFF3 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A -chr2 176957786 176957831 SD5_HOXD13 HOXD13 GCN GCN 22 AD Syndactyly +chr2 176957786 176957831 SPD1_HOXD13 HOXD13 GCN GCN 22 AD Synpolydactyly 1 chr2 191745598 191745646 GDPAG_GLS GLS CAG CAG 680 AR Glutaminase deficiency chr3 63898360 63898391 SCA7_ATXN7 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7 chr3 128891419 128891499 DM2_CNBP CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 diff --git a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed index b9002078..eae92a3a 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed @@ -6,7 +6,7 @@ chr1 155160982 155162030 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC chr1 156561558 156561575 CCGGG,GGGCC NME_NAXE chr2 96862805 96862862 TGAAA,AAAAT FAME2_STARD7 chr2 100721261 100721286 CCG FRA2A_AFF3 -chr2 176957787 176957831 GCN SD5_HOXD13 +chr2 176957787 176957831 GCN SPD1_HOXD13 chr2 191745599 191745646 CAG GDPAG_GLS chr3 63898361 63898391 CAG SCA7_ATXN7 chr3 128891420 128891499 CAGG DM2_CNBP diff --git a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed index fa37a246..da5a0486 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed @@ -5,7 +5,7 @@ chr1 145209323 145209354 CGG NIID_NOTCH2NLC NIID_NOTCH2NLC chr1 156561557 156561575 CCGGG NME_NAXE NME_NAXE chr2 96862804 96862807 AAATG FAME2_STARD7 FAME2_STARD7 chr2 100721260 100721286 CCG FRA2A_AFF3 FRA2A_AFF3 -chr2 176957786 176957831 GCN SD5_HOXD13 SD5_HOXD13 +chr2 176957786 176957831 GCN SPD1_HOXD13 SPD1_HOXD13 chr2 191745598 191745646 CAG GDPAG_GLS GDPAG_GLS chr3 63898360 63898391 CAG SCA7_ATXN7 SCA7_ATXN7 chr3 63898391 63898403 CCG SCA7_ATXN7 SCA7_ATXN7_CCG diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json index 590c265c..e82ab777 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg19.stranger.json @@ -95,14 +95,14 @@ "Gene": "AFF3" }, { - "LocusId": "SD5_HOXD13", + "LocusId": "SPD1_HOXD13", "ReferenceRegion": "chr2:176957786-176957831", "LocusStructure": "(GCN)*", "VariantType": "Repeat", "HGNCId": null, "InheritanceMode": ["AD"], "DisplayRU": "GCN", - "Disease": "SD5", + "Disease": "SPD1", "NormalMax": 15, "PathologicMin": 22, "Gene": "HOXD13" diff --git a/data/catalogs/STRchive-disease-loci.hg19.strkit.bed b/data/catalogs/STRchive-disease-loci.hg19.strkit.bed index 13a566c4..7e6382b0 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.strkit.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.strkit.bed @@ -6,7 +6,7 @@ chr1 155160981 155162030 ID=ADTKD_MUC1;MOTIF=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGC chr1 156561557 156561575 ID=NME_NAXE;MOTIF=CCGGG chr2 96862804 96862862 ID=FAME2_STARD7;MOTIF=TGAAA chr2 100721260 100721286 ID=FRA2A_AFF3;MOTIF=CCG -chr2 176957786 176957831 ID=SD5_HOXD13;MOTIF=GCN +chr2 176957786 176957831 ID=SPD1_HOXD13;MOTIF=GCN chr2 191745598 191745646 ID=GDPAG_GLS;MOTIF=CAG chr3 63898360 63898391 ID=SCA7_ATXN7;MOTIF=CAG chr3 128891419 128891499 ID=DM2_CNBP;MOTIF=CAGG diff --git a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bb b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bb index d453f71e7eeb3edd4c5a6170fdfe2fc997425cea..726b2ccd5b33549b0f438ac8416994ca84ab002b 100644 GIT binary patch delta 681 zcmex=pQ-Hu(*y}d_lc7FLB_TWU|{P6p|3DP=*lPveJ>6|2e3nEsd5M%RSlsXWFhpl z$q@S3^vQwh(>5D0eq^sVn!DvL$HJ|FAJS)(Ddu_Q7$+-C=DXZ;N&G_Zj|jb5j`>Hn z1lJoB>_{&>QT|T0a^Cd!d*AQ3T>9o!k4WUXXPyiK7L0X{|I%sSu}$yu%D@x)0o_3Gj`+;?U7%I&jA-OM8X+@qw?`b~Q_1^oZE`-&@u9=0De3MtPHZ#m!M%Y*LKwlM_|E z8G|RURS{=QoP1P8p7H49r$EwfGOMaQW6ESzAUR>OE0CNyITc9WoZJc|S596EBm*WN z1(FvhKLwJWlUdc|8J|v81(Fvgy8_8YlT(4D_T*L|`DOA_AbEN6Q6RZ|@>3u=eKM=M zJY&OTRdspJMaq!)UAj3?{kG`D4J?~=Y_(XKY@H@QoUX)ZzPZ||MuzEL9GF+TStdSQ whAFBV#N(2KrWhL*u-459>cUK$`zHsmFdm!yV7fBbENIHnL6T>A{i(AZ03$&4MgRZ+ delta 673 zcmZpB!1Vt<(*y}dhl!Hw=ibU|xo}JC$MG%Pg~3U)C7EZIY>-^4zd-uq#+Y9McAeYj zuF7~&aQ@MR_jjxdWtQKlykE<_^v|P~X_W_`dp2-bISF!0@^+d_xe0z=rl%a-bWEf@ ze1TGPW5xr;c?&|;ObK&J4$R+jboIKGCCMSJPopw-=2`m$=E+NKE>UB+UO)fbJ!6fz z#izXIE!)iaR!Asdy3wb%PHiVd*fz8W$fP%?wS2i^oV@hfrcKfc*H?*_2OKJk*peHp znV8x;f6CtD-Rv7%q;`acJ!J+-}(z|KAyh3diIgG+_FmM2@~a6 z0+L@Jn)y38qbK#_Qw6WzZk6d-fj9lE%l~s8mtWn;w|X|jS_xf z2>)O@&kUmLUccjtntVn@o^jvgH$c*SGLNb}W9(!dAlW(D2S`quoC72;P3{4bizcrD zlAe>#0LfF6-vCLc$vkTEjQ1w%0Lhb+eSqZb$vHq$WpWRYd^>p!kUTT_43Jzf`3;bq zFqubPp0RSW4v?I^*+*San#s&*QoItE0W|%vv2IROza+Z3KwXAub7fR33*+_4|KpUo o%An~ekp)R!syu;(DYzP_pHY1C{Aza@rv1}FoXMNHXZ#ii0NxbyUjP6A diff --git a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed index df5719fe..6b95884d 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed @@ -6,7 +6,7 @@ chr1 155160981 155162030 ADTKD_MUC1 0 - 155160981 155162030 0,128,0 MUC1 GGCTNNG chr1 156561557 156561575 NME_NAXE 0 + 156561557 156561575 230,145,0 NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy Limited chr2 96862804 96862862 FAME2_STARD7 0 - 96862804 96862862 64,160,0 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2 Strong chr2 100721260 100721286 FRA2A_AFF3 0 - 100721260 100721286 0,128,0 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A Definitive -chr2 176957786 176957831 SD5_HOXD13 0 + 176957786 176957831 0,128,0 HOXD13 GCN GCN 22 AD Syndactyly Definitive +chr2 176957786 176957831 SPD1_HOXD13 0 + 176957786 176957831 0,128,0 HOXD13 GCN GCN 22 AD Synpolydactyly 1 Definitive chr2 191745598 191745646 GDPAG_GLS 0 + 191745598 191745646 0,128,0 GLS CAG CAG 680 AR Glutaminase deficiency Definitive chr3 63898360 63898391 SCA7_ATXN7 0 + 63898360 63898391 0,128,0 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7 Definitive chr3 128891419 128891499 DM2_CNBP 0 - 128891419 128891499 0,128,0 CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 Definitive diff --git a/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed b/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed index f4f4b659..05428a61 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed @@ -6,7 +6,7 @@ chr1 155188505 155192239 ID=ADTKD_MUC1;MOTIFS=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGG chr1 156591765 156591783 ID=NME_NAXE;MOTIFS=CCGGG,GGGCC;STRUC= chr2 96197066 96197124 ID=FAME2_STARD7;MOTIFS=AAATG,AAAAT,TGAAA;STRUC= chr2 100104798 100104824 ID=FRA2A_AFF3;MOTIFS=CCG;STRUC= -chr2 176093058 176093103 ID=SD5_HOXD13;MOTIFS=GCN;STRUC= +chr2 176093058 176093103 ID=SPD1_HOXD13;MOTIFS=GCN;STRUC= chr2 190880872 190880920 ID=GDPAG_GLS;MOTIFS=CAG;STRUC= chr3 63912684 63912727 ID=SCA7_ATXN7;MOTIFS=CAG,CCG;STRUC= chr3 129172576 129172734 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed index 4afdb665..bace0b9f 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed @@ -7,7 +7,7 @@ chr1 155188505 155192239 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC chr1 156591765 156591783 CCGGG 5 NME_NAXE chr2 96197066 96197069 AAATG 5 FAME2_STARD7 chr2 100104798 100104824 CCG 3 FRA2A_AFF3 -chr2 176093058 176093103 GCN 3 SD5_HOXD13 +chr2 176093058 176093103 GCN 3 SPD1_HOXD13 chr2 190880872 190880920 CAG 3 GDPAG_GLS chr3 63912684 63912715 CAG 3 SCA7_ATXN7 chr3 63912715 63912727 CCG 3 SCA7_ATXN7_flank diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz index fbed3ab17d30726baaa31d1aca8619235f0b3b26..186542660fa2c1b6330ecc8ddf3fa4f39024be6a 100755 GIT binary patch delta 907 zcmV;619be{4%`l~%L9KpV7}ZR10JeZ&M7Acc{(QgG^}CD(`~P!0%A*|sijux=%xv{ zt{u+HeYO0qT4`zN(VwWVxIhXFd#|OZUZ70e@Z6TubEhsfBZ2tqkk@Tl|C)!Fni{WL z9_eQpm}ds{RRp6&*cj>{zSOuM3(7Hv;JnV5Eq?Z1{igxRqmUKu#J0}Z2@I5l5SP>XE|$lgd= zdH>e+m~Y#P)Kzqv+1JB;BL}J6$NF5syoY&cwuch3%badt4MVKgAz&EOP!FKd|L4y? zr2FiZ782FLF$6#uw;|;5vAjmhzk~`}nQ|$tjcb2yvrsE`$mQnN$Q-lpvWMl%x9jzq z*KL@O`l8lK5JftPZktm5O!Wj*Pa0FZ^rhMsO)%ew?=Hu4y-Gcx3`{*@HW2;VR3B45 z#an3G>I29s)Rue)wtY0$E$umMk2i}=x7bU!&e!u9Uz$d8##(7mTAflo;?6@J=HX2$ z&l-QAh6H#huO5B?OI@wpz~FI4+fQ@IVQZ40v07Qv05w9GYVcxs3~Nqd#NH)ZEVCm% z$Z}s_-$G31?e-{FCf#MDtTLtSPR|ALxLt?5-ycs=Jd!FG%t}};f^CvN_B_tpQMz$f hDORSF*!LkhmvavN@?QW-(dnBI001A02n3Tv2N+=m#v%X! delta 907 zcmV;619be{4%`l~%L9L4^X2{+@G!k{PB}Tq(=pGdVGUEBZhI9K5L*&WEwxeyH%-8G z>2O}|tL1mqN=r+J{zQF+1yW$xdo4Zn0%hKY=dPTd8+EA}3B+HAyl%_-*F3z`)Og+U zNI%QKJTs`TA{Z^g#!v_GrN;eKP)<1n=XJ&$_jIanl+Kc}YC3;7CB1voeaz|fz^-Yh zQObI+pr3Q=yv{l9%U3*i(OB_TThqXhfwF4)sR>oxA+TnQ(rowcGzXemy}+H z*Se+bdsj8%RYL>XYvalcY2b7@9Ml~ohUHt>^ES44VZfjm>xC+?(nnKbyzF_s+#l`a zWdN<$rXGt9a-Z5Fc?;`w9&2MPpwgC&(j5>#$vV$ri2w&Xjo?W4JFY0qJMyjg6z#a_B~zMjwc(lnAY)=GoY>XhmUcOLRE4{uU= z)&PGsB)~&?_3#5&>T2Z%29G1!ewsrLTayHh)ykR%s1d?cgBQbNSaS*^_Ab$4nH}*# zmizkp7GgSYw@0}#=`I^(l__O+dM=2^?KE=*Y?J)4=W*VS(v7o9 hu`->+z7NT{9CPTG{{q_TTQQmt001A02n3Tv2N*!h)X4w< diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi index 03ebb84401bf1665b319dfada95f2e60095c9c5a..1affe3b9f78ad76b7f7b8348bbed8516c3aa92c0 100755 GIT binary patch delta 1619 zcmY*Z3pCSv9G^Vq(L9>y!HlqbspOeQd6jHfa`K;7j7nuAk78G7VHL8c7a*!_k zoo%Uyx>H`-Va(nJmbyWwKS&r9BVd%Q<4c9ZrsnPjy^k z%ptJyr#}z+6D5Nnp1}FyMf$Q+AjvL%82^JaBo3OL;d}^yGHb#5YuKhb%7_Hm>3=IN z!o4r6RpulCnG$x-tg#$Q_G04-9?!%DQ+#5%YYUFH)T=>f=_0q;%x`&rdh~~oARCVh zU(T{N`MY#8t0k(pu|QP)u&eRY1! zNENmIvwfK*)bY)`1s0tWwCPXrGN;^Dcb!e_VxHJ`7;Cq|5@%;(i5uuUoOKcdR42Ly z(0C+Ft*a$}VF!*@0SYZTQz?EaQ)5_h%GF?o?B7`et(Qu6slOLWsc6o<){mkd@>yhL zF=7Mxdyd%Tr#2ErpKm&RYkVnr=6Y*e4^;%Er?b1Wu8ds%h5QAN{lCZ|6|CHMdbE@r z%?uK8vo=A){69dQBbEO1#m?@4L_K4e;D} zT1Cm{06f*yyIIAPZ{ZtQS^{=~SUO9|n7*W`Ws?>RO&lUZ2>?+2<1xBnoI+ ztdC<+jDRNY>-*mWE5O+qz8X&4coR;KS+fz|mK#CK)GMI3Ynj14M&KWf*G(!cZy$sS zyIBY?CH+R*tWNs4=^s(0y_ga)DEYG#5%B} z>Vm+P067q#FNFNCw#X3ZUZ0zge0{F$2r#DO*ew-41bZKSv;1G*PHw81{Hq0A>`x4} z3iDT3cKQGl_ORl-WAr^IBx`ELY@F4iLl_!j+FwE*y?SRt^Su+HXnXYZp6A{Tx^fSa z`f?(gGOX$4YaQuHYgCmvQ|GVsulMJ?C(kVsZ6JOPxa`cHGNO{eWC@N!o#Oc*xs<_#>hqYvM;4s}z`Xi;LNArp*qvbX*APHnrRhWW1QbTQRM zrj8*(+1IR#`_WV~L0W=3I>I~T*l{_)LR82VLQu)oK@6!qjzyIIajWx6`W&8X}z9^RXFM> zfC=B0CwRwf$eH-oT+17}OBz6o*gotm9Q&u;R!bv4x*`6&*`f1K^qxveI&O;MlR#;R zkK8KC+x=0*Dl_7|M2JhlL%TqdJt&|=+Ca$wkej>^HZEkqRXg8>`p9HB&v}%C)ZvfzWZ&=tM%tuE8KSIXj?sanz7jna~Vwv_vKD3j_z}!2D;M zpsrvb@gNY1dR>F6A`!UmpzX|CA_0;FT?sqed~3TH;K-MM2QPmQ96uJ?>>Ws*)+ zzl=X?3qXTWS4fUPqeoyGx%&q}4q|-v6MD4`DHc+^AyPh52iD`%Xy%VO!rIyVj&~bX`{{X_P2bur? delta 1629 zcmYjReK?bA7~gnp4q;f1R!Yur6iK0vX-q?}4k@jVVZN@&M{%l2WjW~daXP8?ULjIB zJ1XyrW|Es)TOTe&_8P`Cjl!d;_8E#v~+)SV5yO^ zM)@K${_xqI#205yr@slffCrf~m)Yh&^X79b%w1j1l2&!M^QA255Q99nkufAFSRyNm zFv*N(=tCT&LuS2~som>zR~2|pw3@e{sE8vbPf#m}p~6U5&bHrnj;-j8q<2aOgQZ;0 ziis2|jb1%l(@{)f;+2tCnA*qi;OxcK2eP^vy_opsu|?3_(dWRIeI~}+F4$k$zh5vw zNa#{ETrxX3Ol>_c3YPRoYbg{s*pZ1TEzb;=@iLM(Rb5X0EMe2kNk)MdT$1*zY>5#gXTa$0BE7Sc+ z-{qsDk4`9AP1kcl z>afmbYtF+j)uO7Ggk1QgtH+($&RekRLp_N(<18a-g;{_a6ZnTir?9Aa`)J}9YS@;!_k3qww!+~P|dhp+x@Y7M)dNCWM{xw z%xgnWhu2Y5=k1`9d20cD^RdNHwBG#9%?lfLHfpAJ-0`Q_G?lu@CPPE3dH2F9l3-63 zb#janB=my)G^*PP?^702s@3;Kzjj_(uo@gM?Y)3+zL}14d#VVXvwMh%iT)OH3>0OO z446Cidgu=KDiMl4PLLMpN%8l0B_FIDOrv7%EZ@b`%UO#&Qw{A^IADJ#A=jjqfwtmx zZIGr#8L(Cf&*u4kNB{!s_kV+5h-DcR>6ZT+iwx~5Dbs&nYOZo`7Yd%(i&bgNCffUG_9uwo-17jw1U zOPUd%6FS9PrtQsQ-|_A~-2nT%c4n}T6O&-+R*HrNH)!Og>&s#J$`#%%Jrzk*Nf!&I zH6~IgZTu+;Vj@+dP3xK7jMl=oH0YNfVUx857nw;mT+x*qM{YnG{r2w0oWOsZnJzaR z+Xq}aVNMQm3Vamd!*V|zxCfzM;M0apTbcEooo6dLSm@{|VCC-rbIKDh1Z-e z5_Tq>lc#N^&>LuUdN}K7F)U}m@CXYh9NgX}=Q(=BF;1O@kFG0oYjL%r(2qnW345N3 zcwvllyiOdqzQ>QUZ%kOwmhuy2DkFqN4Hk~JbJaL*!_aohn#b1&U#&5x0eiTKtR1QY zhd`8;!+{|NbRUVc@P4~oJL262v?+~ZbSv&*(HyH0j0t-Et>Pynf)S*_1OT}Pf2g29 HbK8Fb8{inc diff --git a/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json b/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json index b12ea9a9..bdd4b5b1 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json +++ b/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json @@ -48,7 +48,7 @@ "VariantType": "Repeat" }, { - "LocusId": "SD5_HOXD13", + "LocusId": "SPD1_HOXD13", "LocusStructure": "(GCN)*", "ReferenceRegion": "chr2:176093058-176093103", "VariantType": "Repeat" diff --git a/data/catalogs/STRchive-disease-loci.hg38.general.bed b/data/catalogs/STRchive-disease-loci.hg38.general.bed index 9e085340..eb6f0692 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.general.bed @@ -7,7 +7,7 @@ chr1 155188505 155192239 ADTKD_MUC1 MUC1 GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTC chr1 156591765 156591783 NME_NAXE NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy chr2 96197066 96197124 FAME2_STARD7 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2 chr2 100104798 100104824 FRA2A_AFF3 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A -chr2 176093058 176093103 SD5_HOXD13 HOXD13 GCN GCN 22 AD Syndactyly +chr2 176093058 176093103 SPD1_HOXD13 HOXD13 GCN GCN 22 AD Synpolydactyly 1 chr2 190880872 190880920 GDPAG_GLS GLS CAG CAG 680 AR Glutaminase deficiency chr3 63912684 63912715 SCA7_ATXN7 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7 chr3 129172576 129172656 DM2_CNBP CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 diff --git a/data/catalogs/STRchive-disease-loci.hg38.longTR.bed b/data/catalogs/STRchive-disease-loci.hg38.longTR.bed index 10c07a08..328aacb8 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.longTR.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.longTR.bed @@ -6,7 +6,7 @@ chr1 155188506 155192239 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC chr1 156591766 156591783 CCGGG,GGGCC NME_NAXE chr2 96197067 96197124 TGAAA,AAAAT FAME2_STARD7 chr2 100104799 100104824 CCG FRA2A_AFF3 -chr2 176093059 176093103 GCN SD5_HOXD13 +chr2 176093059 176093103 GCN SPD1_HOXD13 chr2 190880873 190880920 CAG GDPAG_GLS chr3 63912685 63912715 CAG SCA7_ATXN7 chr3 129172577 129172656 CAGG DM2_CNBP diff --git a/data/catalogs/STRchive-disease-loci.hg38.straglr.bed b/data/catalogs/STRchive-disease-loci.hg38.straglr.bed index 5c0c556b..40c5d6f5 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.straglr.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.straglr.bed @@ -5,7 +5,7 @@ chr1 149390802 149390842 CGG NIID_NOTCH2NLC NIID_NOTCH2NLC chr1 156591765 156591783 CCGGG NME_NAXE NME_NAXE chr2 96197066 96197069 AAATG FAME2_STARD7 FAME2_STARD7 chr2 100104798 100104824 CCG FRA2A_AFF3 FRA2A_AFF3 -chr2 176093058 176093103 GCN SD5_HOXD13 SD5_HOXD13 +chr2 176093058 176093103 GCN SPD1_HOXD13 SPD1_HOXD13 chr2 190880872 190880920 CAG GDPAG_GLS GDPAG_GLS chr3 63912684 63912715 CAG SCA7_ATXN7 SCA7_ATXN7 chr3 63912715 63912727 CCG SCA7_ATXN7 SCA7_ATXN7_CCG diff --git a/data/catalogs/STRchive-disease-loci.hg38.stranger.json b/data/catalogs/STRchive-disease-loci.hg38.stranger.json index 802553c4..ef3507d8 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg38.stranger.json @@ -95,14 +95,14 @@ "Gene": "AFF3" }, { - "LocusId": "SD5_HOXD13", + "LocusId": "SPD1_HOXD13", "ReferenceRegion": "chr2:176093058-176093103", "LocusStructure": "(GCN)*", "VariantType": "Repeat", "HGNCId": null, "InheritanceMode": ["AD"], "DisplayRU": "GCN", - "Disease": "SD5", + "Disease": "SPD1", "NormalMax": 15, "PathologicMin": 22, "Gene": "HOXD13" diff --git a/data/catalogs/STRchive-disease-loci.hg38.strkit.bed b/data/catalogs/STRchive-disease-loci.hg38.strkit.bed index 92cb2570..8ee3ab20 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.strkit.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.strkit.bed @@ -6,7 +6,7 @@ chr1 155188505 155192239 ID=ADTKD_MUC1;MOTIF=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGC chr1 156591765 156591783 ID=NME_NAXE;MOTIF=CCGGG chr2 96197066 96197124 ID=FAME2_STARD7;MOTIF=TGAAA chr2 100104798 100104824 ID=FRA2A_AFF3;MOTIF=CCG -chr2 176093058 176093103 ID=SD5_HOXD13;MOTIF=GCN +chr2 176093058 176093103 ID=SPD1_HOXD13;MOTIF=GCN chr2 190880872 190880920 ID=GDPAG_GLS;MOTIF=CAG chr3 63912684 63912715 ID=SCA7_ATXN7;MOTIF=CAG chr3 129172576 129172656 ID=DM2_CNBP;MOTIF=CAGG diff --git a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bb b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bb index 50cb3a381479ac5376b8bfbcc0838fd01ca5f7c2..4c6ea8b07a7f53e6db5d002d3a09864c6672de0d 100755 GIT binary patch delta 669 zcmdn^g%c(9gJNwNz@X0wLPsz`=u=S;IxrqWCvZaO-f{^2r5Zvvs6uFi zDG<7G#^grzX`2lgf3VlL9Fbhx!lF{QY8kWeL6yAhlfJ8tv7R|_KvQA|Gy4nP9gHzc zwEd(MU6%M)9-h2EonQ9&&p)^L`1WmYZi$^Y$!7K@PZ-a_yqrER{6lt?RaQ884 zR9ibqpP0Q&Pv!cemi{392RUb-m$Bt65!+DQ6mcd+b!&~l-38b0o_^S_Dt+9-e)qo4 z!rd=89vpCA*zK1w-=L^o{OeYeU9S|DxX+z3Gb>a(_>+@#s=`10s6F?2@9SjRq-D;F zOR4tl&~PO<`(F*ZwY&frp! zVl158tKuyg!3YUvejxS6>O3=ueq{NXD|hlo6?w)BlLb}f8Qmuv0?Fjbfk3iCJ`e7Sc?8PLl;|lo%5?pL3cg!xR_~=AGL- xF}_ZQ@yld^8fC7D&~%f`vbjf%hBwWk!aFac8xNUzD}gEM}M0|0+O^=beB delta 685 zcmX^3kZI3DrU?>^ITI!IgCcAhz@XC!LPsz`=%Y~(+9w`DCvZaOj&cb7z8XR|s6uG% zDG<75#^grzX`2lgf3Vjt=`@bwH1znh^5p>+gU;JgMUz(*HX0ZdaIw8Rz*xnc#~}W) zYqFb%z{}u!AD+Cw>3qD~~AsT*F(%;|BqewWtsa~DqK z&o6IQ_clswN!9VZnmI-E-J=#nyRK-LiCxH*b9AboJ4_ zJ_BBn(%7e75|IboQ^g9li4|KjUpwV-!_rYFeN~8??TNe#uiriWaCp+O$8Wy8Qako` zfpP=0e5;<+WxK>D|M*^I+w6Lyuq4)Lidm{+(d8G<_9uRb;pI!!hMl5vy6fMnO?G9Wo~@-!fMck(tMxpwk3AQ?XS z8<0FVSxilyF<`P8kbFHk3`pLbTm~dJPM!uN9VTxBlAM#T0m*lhzX8dElf~5K88=Ke z1Cp~RhpEeR9#e+I@3PH}>UTspN7;t3GIma0@1)EX15H7?tPrUQ>OxGLPem3uawim_+2Wle?*6EM+$6zW6MkS|yv%j-{_?EsSa B{yYEx diff --git a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed index 98b7e0ce..c9574eed 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed @@ -6,7 +6,7 @@ chr1 155188505 155192239 ADTKD_MUC1 0 - 155188505 155192239 0,128,0 MUC1 GGCTNNG chr1 156591765 156591783 NME_NAXE 0 + 156591765 156591783 230,145,0 NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy Limited chr2 96197066 96197124 FAME2_STARD7 0 - 96197066 96197124 64,160,0 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2 Strong chr2 100104798 100104824 FRA2A_AFF3 0 - 100104798 100104824 0,128,0 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A Definitive -chr2 176093058 176093103 SD5_HOXD13 0 + 176093058 176093103 0,128,0 HOXD13 GCN GCN 22 AD Syndactyly Definitive +chr2 176093058 176093103 SPD1_HOXD13 0 + 176093058 176093103 0,128,0 HOXD13 GCN GCN 22 AD Synpolydactyly 1 Definitive chr2 190880872 190880920 GDPAG_GLS 0 + 190880872 190880920 0,128,0 GLS CAG CAG 680 AR Glutaminase deficiency Definitive chr3 63912684 63912715 SCA7_ATXN7 0 + 63912684 63912715 0,128,0 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7 Definitive chr3 129172576 129172656 DM2_CNBP 0 - 129172576 129172656 0,128,0 CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 Definitive diff --git a/data/criTRia-curations.tsv b/data/criTRia-curations.tsv index 009aa485..0d526dfd 100644 --- a/data/criTRia-curations.tsv +++ b/data/criTRia-curations.tsv @@ -19,7 +19,7 @@ DIP2B FRA12A AD 05/20/2026 Disputed 10.5 9.5 1.0 6 19.32 FRA12A is a rare, folat DMD DMD XR 05/14/2025 Refuted 0 0 0 2 8.65 A GAA repeat expansion in DMD intron 62 was proposed as a possible contributor to Duchenne/Becker-like dystrophinopathy based on a single three-generation family in which affected female relatives carried expanded alleles and population controls in that study had smaller alleles [@pmid:27417533]. However, large population analyses found the proposed pathogenic genotype at frequencies far exceeding expectations for a highly penetrant early-onset X-linked disorder, supporting refutation of the DMD repeat expansion as a pathogenic disease-causing locus [@pmid:40140942]. DMPK DM1 AD 07/21/2025 Definitive 18 12 6 7 30.58 Myotonic dystrophy type 1 (DM1) is an autosomal dominant, multisystem repeat-expansion disorder caused by a pathogenic CTG expansion in the 3' UTR of DMPK. The locus-disease relationship is supported by molecularly confirmed DMPK CTG expansions in affected probands, population/control allele data, repeat-length and repeat interruptions that modify age at onset and severity, and experimental evidence showing toxic expanded CUG RNA with nuclear foci, RNA-binding protein sequestration, disease-relevant cellular and mouse phenotypes, and partial rescue after modulation of pathogenic RNA-binding pathways. EIF4A3 RCPS AR 06/02/2025 Definitive 15 9 6 3 4.24 Richieri-Costa-Pereira syndrome (RCPS) is an autosomal recessive acrofacial dysostosis caused primarily by biallelic EIF4A3 5' UTR repeat expansions, most commonly 15-16 repeats compared with 3-12 repeats in controls, with additional pathogenic compound heterozygosity involving a 14-repeat allele and EIF4A3 missense variant. The locus-disease relationship is supported by affected families/probands with biallelic EIF4A3 variants, linkage and segregation at 17q25.3, reduced EIF4A3 expression and neural crest/osteochondrogenic defects in patient-derived cells, and zebrafish and mouse models of EIF4A3 deficiency that reproduce craniofacial developmental abnormalities relevant to RCPS. -FGF14 SCA27B AR 06/04/2025 Definitive 13.5 12 1.5 6 22.41 SCA27B/ATX-FGF14 is associated with a pathogenic intronic GAA repeat expansion in FGF14, with cohort data supporting a fully pathogenic range for larger expansions and reduced penetrance for intermediate alleles. Affected individuals typically present with adult-onset, slowly progressive cerebellar ataxia, often with episodic features, gait/balance impairment, ocular motor findings, and cerebellar pathology. Supporting experimental evidence includes FGF14 gene-level mouse and protein-interaction studies. +FGF14 SCA27B AD 06/04/2025 Definitive 13.5 12 1.5 6 22.41 SCA27B/ATX-FGF14 is associated with a pathogenic intronic GAA repeat expansion in FGF14, with cohort data supporting a fully pathogenic range for larger expansions and reduced penetrance for intermediate alleles. Affected individuals typically present with adult-onset, slowly progressive cerebellar ataxia, often with episodic features, gait/balance impairment, ocular motor findings, and cerebellar pathology. Supporting experimental evidence includes FGF14 gene-level mouse and protein-interaction studies. FMR1 FXS XD 08/18/2025 Definitive 14.0 8.5 5.5 13 39.09 Fragile X syndrome (FXS) is caused by full-mutation expansion of the CGG repeat (typically >200 repeats) in the 5′ untranslated region of FMR1. The full mutation leads to repeat-region hypermethylation, transcriptional silencing of FMR1, and reduced or absent FMRP, an RNA-binding protein involved in synaptic protein translation, brain development, and synaptic plasticity. The FMR1 full-mutation FXS locus-disease relationship is established and replicated over time. FMR1 FXTAS,POF1 XD 08/18/2025 Definitive 13.5 11.0 2.5 5 5.29 The FMR1 5' UTR CGG premutation (55-200 repeats) is associated with the grouped FXTAS/POF1 phenotype in criTRia. Uploaded FXTAS-focused sources support a locus-specific relationship between premutation CGG repeat length and motor phenotype, including earlier onset of tremor/ataxia and greater motor impairment in premutation carriers, especially males. Experimental support in the uploaded sources is limited to FMR1 repeat/mRNA measurements in blood-derived cells and should be interpreted as indirect regulatory/functional alteration evidence rather than a dedicated cell model assay. FOXL2 BPES AD/AR 06/04/2025 Definitive 14.5 9.0 5.5 6 19.47 FOXL2 pathogenic variants, including polyalanine-tract expansions, are associated with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES), an eyelid malformation syndrome with or without premature ovarian failure. Reported evidence includes multiple unrelated probands and families with heterozygous FOXL2 variants, segregation of a polyalanine expansion in a multigeneration BPES type II family, absence from controls/population databases, conservation and in silico support for a polyalanine-region insertion, and experimental data showing altered FOXL2 localization, aggregation, transactivation, and BPES-like eyelid/ovarian phenotypes in models. @@ -27,13 +27,13 @@ GIPC1 OPDM2 AD 06/04/2025 Definitive 15.5 9.5 6.0 6 4.99 Autosomal dominant OPDM HOXA13 HFG-I AD 08/18/2025 Limited 3.5 0 3.5 2 3.08 This HFG-I HOXA13 curation is based on experimental evidence from PMID 17935235 and primary mouse-model evidence from PMID 15385446. PMID 17935235 reports a father and daughter with hand-foot-genital syndrome carrying a heterozygous +14 alanine expansion in HOXA13 polyalanine tract III and shows, in COS-7 cells, length-dependent cytoplasmic aggregation of HOXA13 polyalanine expansion proteins, altered steady-state abundance after geldanamycin treatment, and sequestration of wild-type HOXA13/HOXD13. PMID 15385446 reports human HOXA13 polyalanine expansions in all three large tracts and a Hoxa13Ala28 knock-in mouse model with a +10 alanine expansion in tract III, showing a Hoxa13 loss-of-function-like phenotype with normal RNA expression/splicing but reduced steady-state HOXA13 protein abundance. Evidence is primarily experimental and supports a loss-of-function mechanism through post-transcriptional reduction/degradation of expanded HOXA13 protein. Note that there are three reported pathogenic polyalanine tracts in HOXA13 and only PMID 17935235 was able to be directly tied to this specific tract. HOXA13 HFG-II AD 08/18/2025 Limited 5.5 3.0 2.5 2 1.63 Autosomal dominant hand-foot-genital syndrome type II (HFG-II) is supported by a heterozygous 18 bp in-frame duplication in the second HOXA13 polyalanine tract, adding six alanines. The locus-specific human evidence comes from a six-generation family with 27 affected individuals, atypical HFGS with mild limb findings and high hypospadias penetrance, significant linkage to chromosome 7p (maximum LOD 6.70 at D7S503), segregation of the HOXA13-II duplication in available affected relatives, and absence of the duplication from 100 Swedish controls. HOXA13 HFG-III AD 08/18/2025 Limited 4.5 2.0 2.5 3 7.46 Autosomal dominant hand-foot-genital syndrome type III (HFG-III) is associated with expansions of the third N-terminal polyalanine tract in HOXA13. PMID 10839976 reported an HFGS family with a 24-bp in-frame insertion in exon 1 that expands HOXA13 polyalanine tract III from 18 to 26 alanines and segregates across multiple affected relatives. PMID 17935235 reported a father-daughter family with a 42-bp insertion adding 14 alanines to the same tract and showed that expanded HOXA13 proteins mislocalize to cytoplasmic aggregates, show reduced steady-state abundance, and can sequester wild-type HOXA13/HOXD13 in transfected cells. -HOXD13 SD5 AD 08/18/2025 Definitive 12.5 8.5 4.0 3 24.09 Autosomal dominant synpolydactyly type 5 is associated with in-frame polyalanine expansions in exon 1 of HOXD13, a coding tandem-repeat tract outside the DNA-binding homeodomain. Published families show HOXD13 polyalanine expansions segregating with synpolydactyly, with expansion size correlating with penetrance and limb phenotype severity. Functional studies in a Hoxd13 +7A synpolydactyly mouse model and transcription-factor condensate assays support a repeat-expansion mechanism that alters HOXD13 condensate composition and downstream transcriptional programs during limb development. +HOXD13 SPD1 AD 08/18/2025 Definitive 12.5 8.5 4.0 3 24.09 Autosomal dominant synpolydactyly type 1 is associated with in-frame polyalanine expansions in exon 1 of HOXD13, a coding tandem-repeat tract outside the DNA-binding homeodomain. Published families show HOXD13 polyalanine expansions segregating with synpolydactyly, with expansion size correlating with penetrance and limb phenotype severity. Functional studies in a Hoxd13 +7A synpolydactyly mouse model and transcription-factor condensate assays support a repeat-expansion mechanism that alters HOXD13 condensate composition and downstream transcriptional programs during limb development. JPH3 HDL2 AD 06/04/2025 Definitive 15 9 6 5 23.58 HDL2 is an autosomal dominant Huntington disease phenocopy caused by a CAG/CTG repeat expansion in alternatively spliced exon 2A of JPH3. Human evidence includes published genetically confirmed HDL2 cases, an inverse relationship between repeat length and age at onset, and shared African-origin founder haplotypes in multiple populations. Experimental evidence includes BAC-HDL2 mouse models with motor and neurodegenerative phenotypes, CUG RNA foci and polyQ nuclear inclusions, gene-level Drosophila junctophilin models modifying neuronal/polyQ phenotypes, and localization of the repeat to alternatively spliced JPH3 exon 2A. LRP12 OPDM1 AD 8/18/2025 Strong 12 12 0 2 1.92 Autosomal dominant oculopharyngodistal myopathy type 1 (OPDM1) is associated with a heterozygous noncoding CGG repeat expansion in the 5′ UTR of LRP12. The original discovery study identified LRP12 CGG expansions in OPDM probands and validated the locus by RP-PCR, Southern blotting, and control repeat-size analysis. A larger OPDM_LRP12 case series identified 65 Japanese patients from 59 families with 85–289 CGG repeats, supporting an inverse relationship between repeat size and age at onset and defining the phenotype as oculopharyngeal weakness with predominantly distal myopathy and rimmed vacuoles. MARCHF6 FAME3 AD 08/12/2025 Definitive 11.5 10.0 1.5 3 17.33 Autosomal dominant familial adult myoclonic epilepsy type 3 (FAME3) is associated with an intronic TTTTA/TTTCA repeat expansion in MARCH6/MARCHF6 on chromosome 5p15.2. The expansion was identified by genome sequencing and repeat-primed PCR in four European families with cortical/myoclonic tremor and epilepsy, co-segregated with disease, and was absent from controls in the reported analyses. Expansion length, particularly the TTTCA component, inversely correlated with age at seizure onset. Patient-derived blood cells and fibroblasts showed marked somatic instability and expansion-size variability. MIR7-2 CHNG3 AD 08/18/2025 Strong 13.5 12 1.5 2 Noncoding TTTG STR changes at 15q26.1 between DET1 and MIR7-2/MIR1179 are associated with autosomal dominant CHNG3/resistance to TSH, presenting as congenital nongoitrous hypothyroidism and/or multinodular goiter. Two 2024 studies reported recurrent (TTTG)3 deletions and STR SNVs segregating in families and enriched in congenital hypothyroidism/MNG cohorts, with locus-specific functional evidence that the STR has thyroid-specific regulatory activity and that pathogenic STR variants disrupt or activate regulatory programs affecting MIR7-2/MIR1179 expression in thyroid tissue. NAXE NME AR 08/12/2025 Limited 5.0 2.0 3.0 1 A biallelic GGGCC repeat expansion of approximately 200 repeat units in the NAXE promoter was identified in one proband with autosomal recessive NAXE-related mitochondrial encephalopathy. The proband's homozygous expansion resulted from maternal chromosome 1 uniparental disomy, with the mother carrying the expansion heterozygously. The expansion was detected by long-read sequencing and supported by RP-PCR/Southern blot family testing, marked reduction of NAXE RNA and protein, reduced nascent promoter transcripts by NET-CAGE, and CpG hypermethylation at and downstream of the repeat. Screening of additional undiagnosed mitochondrial encephalopathy cases did not identify another pathogenic expansion, and available cohort/population data indicate that expanded alleles are very rare. To date, this locus-disease relationship is supported by one publication. -NIPA ALS1 AD 06/06/2025 Disputed 3.0 2.0 1.0 3 2.33 The NIPA1 exon 1 GCG/polyalanine repeat has been reported as an ALS risk or modifier locus, with some European cohorts showing enrichment or survival effects for long alleles (≥9 or >8 GCG repeats), whereas African-ancestry and broader Project MinE STR studies did not confirm an ALS susceptibility or age-at-onset association. The evidence is conflicting and largely association-based, with limited direct locus-specific evidence, supporting the disputed classification. The evidence does not currently support a Mendelian association between the NIPA1 repeat and ALS. +NIPA1 ALS1 AD 06/06/2025 Disputed 3.0 2.0 1.0 3 2.33 The NIPA1 exon 1 GCG/polyalanine repeat has been reported as an ALS risk or modifier locus, with some European cohorts showing enrichment or survival effects for long alleles (≥9 or >8 GCG repeats), whereas African-ancestry and broader Project MinE STR studies did not confirm an ALS susceptibility or age-at-onset association. The evidence is conflicting and largely association-based, with limited direct locus-specific evidence, supporting the disputed classification. The evidence does not currently support a Mendelian association between the NIPA1 repeat and ALS. NOP56 SCA36 AD 08/11/2025 Definitive 13.0 12 1.0 4 13.75 Autosomal dominant spinocerebellar ataxia 36 (SCA36) is caused by a heterozygous intronic GGCCTG hexanucleotide repeat expansion in NOP56. The relationship is supported by multiple SCA36 cohorts and families with repeat-positive affected individuals, autosomal dominant segregation/linkage evidence, and cohort screening showing NOP56 expansions among undiagnosed hereditary ataxia cases. Experimental support is mainly gene-level: NOP56 functions in box C/D snoRNP biogenesis and ribosomal RNA methylation, while several cited functional evidence rows require curator review because the provided sources do not directly test the SCA36 repeat locus. NOTCH2NLC NIID AD 08/14/2025 Definitive 14.0 12 2.0 8 5.08 Autosomal dominant NIID is caused by heterozygous GGC/CGG repeat expansions in the 5′ UTR of NOTCH2NLC (also reported as NBPF19/NOTCH2NLC). The association is supported by independent long-read sequencing and repeat-primed/GC-rich PCR studies in familial and sporadic NIID, segregation in affected families, expansion enrichment in disease cohorts compared with controls, and replicated clinical/pathologic findings including multisystem neurodegeneration, characteristic DWI corticomedullary-junction hyperintensity/white matter disease, and eosinophilic p62/ubiquitin-positive intranuclear inclusions. Reported functional observations include altered methylation/regulatory findings and patient tissue pathology. NUTM2B-AS1 OPML1 AD 08/18/2025 Moderate 9.5 7.5 2.0 4 5.0 A heterozygous CGG/CCG repeat expansion in overlapping noncoding exons of bidirectionally transcribed LOC642361/NUTM2B-AS1 is associated with autosomal dominant OPML1/LOC642361-NUTM2B-AS1-related oculopharyngeal myopathy spectrum. The original report identified the expansion in one Japanese OPML family with leukoencephalopathy, with segregation in affected relatives and absence in unaffected relatives and 1,000 controls. Subsequent independent reports identified OPDM-predominant cases from Chinese and Thai families, expanding the phenotype and showing variable or absent leukoencephalopathy. Patient-muscle studies showed rimmed vacuoles, p62-positive intranuclear inclusions, aggrephagy/RNA-binding protein accumulation, and mitochondrial abnormalities, supporting a repeat-mediated pathogenic mechanism. @@ -41,7 +41,7 @@ PABPN1 OPMD AD/AR 08/14/2025 Definitive 12.5 12 0.5 5 24.58 Oculopharyngeal musc PLIN4 MRUPAV AD 08/11/2025 Moderate 11.0 7.5 3.5 6 5.17 Autosomal dominant MRUPAV/PLIN4-related vacuolar myopathy is caused by heterozygous coding 99-bp repeat expansions in PLIN4 within the exon encoding the amphipathic perilipin-4 domain. Reported affected families and sporadic cases show adult-onset distal and/or proximal myopathy, rimmed/autophagic vacuoles, and subsarcolemmal or cytoplasmic PLIN4/perilipin-4 aggregates that co-localize with p62/SQSTM1, FK2, NBR1, and other aggrephagy markers. Expanded alleles have been detected by PCR and long-read sequencing, with supporting linkage/segregation, absence from unaffected relatives or controls, and patient muscle studies showing expanded PLIN4 protein and aggrephagy activation. POLG CPEO 08/18/2025 Disputed 7.0 6.0 1.0 1 The curated POLG CAG/polyglutamine repeat has disputed relevance to CPEO. The provided sources evaluate the repeat primarily as a modifier/association signal in Parkinson disease and Friedreich ataxia, and note that pathogenic POLG coding variants can cause progressive external ophthalmoplegia; they do not provide direct evidence that POLG CAG-repeat variation causes CPEO. PPP2R2B SCA12 AD 08/11/2025 Moderate 8.5 7.0 1.5 3 24.58 Spinocerebellar ataxia 12 (SCA12) is an autosomal dominant repeat expansion disorder associated with a CAG repeat expansion in the 5′ region/promoter of PPP2R2B. Reported families support segregation of expanded alleles with an adult-onset phenotype that often begins with coarse action tremor of the hands/head and later develops cerebellar ataxia; incomplete/age-dependent penetrance has been reported. The locus is rare globally but enriched in a northern Indian founder population. PPP2R2B encodes the brain-enriched PP2A-PR55β regulatory subunit; the pathogenic mechanism is still incompletely established, with proposed regulatory effects and possible gain-of-function/RAN-translation mechanisms. -PRDM12 HSAN-VIII AR 08/14/2025 Moderate 11.0 5.0 6 1 Homozygous PRDM12 polyalanine repeat expansions were reported in two unrelated families with autosomal recessive congenital insensitivity to pain / HSAN-VIII. The TR-specific genetic evidence includes a 19-alanine expansion in family A and an 18-alanine expansion in family J, both exceeding the maximum 14-alanine tract observed in the tested general population. Experimental evidence supports PRDM12 function in nociceptor development and epigenetic regulation, including DRG/nociceptor expression, patient sensory fiber loss, polyalanine-mutant aggregation in transfected cells, and Xenopus sensory placode defects after Prdm12 knockdown. The relationship is currently Moderate, based on one publication without independent replication over time. +PRDM12 HSAN VIII AR 08/14/2025 Moderate 11.0 5.0 6 1 Homozygous PRDM12 polyalanine repeat expansions were reported in two unrelated families with autosomal recessive congenital insensitivity to pain / HSAN-VIII. The TR-specific genetic evidence includes a 19-alanine expansion in family A and an 18-alanine expansion in family J, both exceeding the maximum 14-alanine tract observed in the tested general population. Experimental evidence supports PRDM12 function in nociceptor development and epigenetic regulation, including DRG/nociceptor expression, patient sensory fiber loss, polyalanine-mutant aggregation in transfected cells, and Xenopus sensory placode defects after Prdm12 knockdown. The relationship is currently Moderate, based on one publication without independent replication over time. PRNP CJD AD 08/14/2025 Moderate 8.5 7.5 1.0 4 34.09 PRNP octapeptide repeat insertions (OPRIs) in the exon 2/N-terminal coding repeat region are associated with autosomal dominant genetic Creutzfeldt-Jakob disease/inherited prion disease. Uploaded sources describe the normal five-octapeptide repeat structure, familial CJD/CJD-GSS cases with expanded alleles, published OPRI genetic CJD case summaries across 1–7 additional repeats, and newer 5-OPRI reports with atypical frontotemporal dementia-like or Huntington disease-like presentations. RAI1 FAME8 AD 08/14/2025 Limited 1.5 1.5 0.0 2 0.45 FAME8 is an autosomal dominant benign adult familial myoclonic epilepsy caused by an intronic RAI1 TTTTA repeat expansion followed by TTTCA repeat insertion. The locus was reported in a large Malian family, where the expansion co-segregated with disease in affected relatives and TTTCA insertions were absent from Malian controls. RAI1 blood RNA studies did not show altered expression, suggesting RAI1 haploinsufficiency is unlikely; the disease mechanism remains uncertain and likely repeat-dependent. RAPGEF2 FAME7 AD 08/14/2025 Limited 3 3 0 2 0.91 Intronic TTTCA repeat expansions in RAPGEF2 have been reported in autosomal dominant familial adult myoclonic epilepsy/familial cortical myoclonic tremor with epilepsy (FAME7/BAFME7/FCMTE). Evidence includes one Japanese BAFME family (F8241) with a RAPGEF2 intron 14 TTTCA expansion confirmed by WGS, RP-PCR and Southern blot, and one Chinese FCMTE family with RAPGEF2 TTTCA expansion detected by RP-PCR. Expanded TTTCA repeats in RAPGEF2 were absent from tested controls, but no RAPGEF2-specific experimental evidence has been reported; current classification remains Limited. diff --git a/data/plots/path-size.json b/data/plots/path-size.json index 5d0bc35a..8349a960 100644 --- a/data/plots/path-size.json +++ b/data/plots/path-size.json @@ -13,7 +13,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 110, 66, 198, 0, 143, 99, 54, 54, 0, 51, 780, 25, 513, 51, 51, 105, 117, 149, 0, 0, 39, 0, 12, 30, 123, 222, 60, 0, 220, 96, 179, 95, 59, 105, 60, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 42, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -29,7 +29,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 4085, 3804, 0, 0, 246, 0, 945, 0, 0, 129, 0, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 0, 60, 0, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 15, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -45,7 +45,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 18500, 11100, 1287, 1925, 705, 2460, 11750, 2268, 1420, 0, 294, 0, 1851, 0, 99, 5397, 5397, 12, 3250, 17875, 1617, 820, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 195, 273, 114, 3687, 18, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -1124,7 +1124,7 @@ "mode": "lines", "showlegend": false, "x": [45, 66], - "y": ["SD5", "SD5"], + "y": ["SPD1", "SPD1"], "type": "scatter" }, { @@ -1347,7 +1347,7 @@ "name": "Benign", "showlegend": false, "x": [96, 45, 45, 42, 45, 45, 36, 36, 42, 30, 30, 15, 16, 30, 20], - "y": ["CJD", "TOF", "HPE5", "HFG-I", "SD5", "XLID, PHPX", "PRTS", "HFG-II", "BPES", "OPMD", "VACTERLX", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["CJD", "TOF", "HPE5", "HFG-I", "SPD1", "XLID, PHPX", "PRTS", "HFG-II", "BPES", "OPMD", "VACTERLX", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "scatter" }, { @@ -1944,7 +1944,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "tickvals": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "title": { "text": "Disease" diff --git a/data/ref-alleles/ref-alleles.T2T-chm13.txt b/data/ref-alleles/ref-alleles.T2T-chm13.txt index efecc5ea..e7999ae8 100644 --- a/data/ref-alleles/ref-alleles.T2T-chm13.txt +++ b/data/ref-alleles/ref-alleles.T2T-chm13.txt @@ -46,7 +46,7 @@ chr2 100563685 100563738 CCG TRGT CGCTGCTGCA G CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG C GGTGCTCTGC CGCTGCTGCA G CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG CCG C GGTGCTCTGC -SD5_HOXD13 +SPD1_HOXD13 chr2 176581179 176581224 GCN STRchive chr2 176581179 176581224 GCN TRGT TTCGGGGCGG GCG GCG GCG GCG GCA GCG GCG GCT GCG GCG GCG GCA GCG GCA GCC TCCGGCTTTG diff --git a/data/ref-alleles/ref-alleles.hg19.txt b/data/ref-alleles/ref-alleles.hg19.txt index 372ed2ef..05f49ddd 100644 --- a/data/ref-alleles/ref-alleles.hg19.txt +++ b/data/ref-alleles/ref-alleles.hg19.txt @@ -46,7 +46,7 @@ chr2 100721260 100721286 CCG TRGT CGCTGCTGCA G CCG CCG CCG CCG CCG CCG CCG CCG C GGTGCTCTGC CGCTGCTGCA G CCG CCG CCG CCG CCG CCG CCG CCG C GGTGCTCTGC -SD5_HOXD13 +SPD1_HOXD13 chr2 176957786 176957831 GCN STRchive chr2 176957786 176957831 GCN TRGT TTCGGGGCGG GCG GCG GCG GCG GCA GCG GCG GCT GCG GCG GCG GCG GCG GCA GCC TCCGGCTTTG diff --git a/data/ref-alleles/ref-alleles.hg38.txt b/data/ref-alleles/ref-alleles.hg38.txt index 854be0ce..ae54a50c 100644 --- a/data/ref-alleles/ref-alleles.hg38.txt +++ b/data/ref-alleles/ref-alleles.hg38.txt @@ -46,7 +46,7 @@ chr2 100104798 100104824 CCG TRGT CGCTGCTGCA G CCG CCG CCG CCG CCG CCG CCG CCG C GGTGCTCTGC CGCTGCTGCA G CCG CCG CCG CCG CCG CCG CCG CCG C GGTGCTCTGC -SD5_HOXD13 +SPD1_HOXD13 chr2 176093058 176093103 GCN STRchive chr2 176093058 176093103 GCN TRGT TTCGGGGCGG GCG GCG GCG GCG GCA GCG GCG GCT GCG GCG GCG GCG GCG GCA GCC TCCGGCTTTG From 7d49a63d3ecef8e26faba68c66a1febf4dc9342d Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Fri, 2 Oct 2026 18:06:36 -0600 Subject: [PATCH 13/18] Use HSAN-VIII as the disease ID for HSAN-VIII_PRDM12 Avoid a space inside a disease ID, since ", " separates multiple disease IDs and disease_id is written into the catalogs. Matches the locus ID and other hyphenated IDs (HFG-I, aFTLD-U). Applied to both STRchive and criTRia. Co-Authored-By: Claude Opus 5.5 --- data/STRchive-loci.json | 2 +- data/criTRia-curations.json | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 92f10399..b9d6aae9 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -4007,7 +4007,7 @@ }, { "id": "HSAN-VIII_PRDM12", - "disease_id": "HSAN VIII", + "disease_id": "HSAN-VIII", "gene": "PRDM12", "evidence": ["Moderate"], "chrom": "chr9", diff --git a/data/criTRia-curations.json b/data/criTRia-curations.json index c96d63b3..7ed8dd97 100644 --- a/data/criTRia-curations.json +++ b/data/criTRia-curations.json @@ -4634,7 +4634,7 @@ "classification": "Moderate" }, { - "Disease_ID": "HSAN VIII", + "Disease_ID": "HSAN-VIII", "Gene": "PRDM12", "Locus_ID": "HSAN-VIII_PRDM12", "Inheritance": "AR", From 92e09c29da875b186bd83ae97ec2bdc2e5955540 Mon Sep 17 00:00:00 2001 From: hdashnow <3794821+hdashnow@users.noreply.github.com> Date: Sat, 3 Oct 2026 00:17:37 +0000 Subject: [PATCH 14/18] Update data --- .../STRchive-disease-loci.T2T-chm13.stranger.json | 2 +- data/catalogs/STRchive-disease-loci.hg19.stranger.json | 2 +- data/catalogs/STRchive-disease-loci.hg38.stranger.json | 2 +- data/criTRia-curations.tsv | 2 +- data/plots/path-size.json | 10 +++++----- 5 files changed, 9 insertions(+), 9 deletions(-) diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json index 973cf3bf..1d4c4bce 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json @@ -447,7 +447,7 @@ "HGNCId": null, "InheritanceMode": ["AR"], "DisplayRU": "CCG", - "Disease": "HSAN VIII", + "Disease": "HSAN-VIII", "NormalMax": 14, "PathologicMin": 18, "Gene": "PRDM12" diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json index e82ab777..14f5ecfa 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg19.stranger.json @@ -447,7 +447,7 @@ "HGNCId": null, "InheritanceMode": ["AR"], "DisplayRU": "CCG", - "Disease": "HSAN VIII", + "Disease": "HSAN-VIII", "NormalMax": 14, "PathologicMin": 18, "Gene": "PRDM12" diff --git a/data/catalogs/STRchive-disease-loci.hg38.stranger.json b/data/catalogs/STRchive-disease-loci.hg38.stranger.json index ef3507d8..b800d2e7 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg38.stranger.json @@ -447,7 +447,7 @@ "HGNCId": null, "InheritanceMode": ["AR"], "DisplayRU": "CCG", - "Disease": "HSAN VIII", + "Disease": "HSAN-VIII", "NormalMax": 14, "PathologicMin": 18, "Gene": "PRDM12" diff --git a/data/criTRia-curations.tsv b/data/criTRia-curations.tsv index 0d526dfd..f47b7ee1 100644 --- a/data/criTRia-curations.tsv +++ b/data/criTRia-curations.tsv @@ -41,7 +41,7 @@ PABPN1 OPMD AD/AR 08/14/2025 Definitive 12.5 12 0.5 5 24.58 Oculopharyngeal musc PLIN4 MRUPAV AD 08/11/2025 Moderate 11.0 7.5 3.5 6 5.17 Autosomal dominant MRUPAV/PLIN4-related vacuolar myopathy is caused by heterozygous coding 99-bp repeat expansions in PLIN4 within the exon encoding the amphipathic perilipin-4 domain. Reported affected families and sporadic cases show adult-onset distal and/or proximal myopathy, rimmed/autophagic vacuoles, and subsarcolemmal or cytoplasmic PLIN4/perilipin-4 aggregates that co-localize with p62/SQSTM1, FK2, NBR1, and other aggrephagy markers. Expanded alleles have been detected by PCR and long-read sequencing, with supporting linkage/segregation, absence from unaffected relatives or controls, and patient muscle studies showing expanded PLIN4 protein and aggrephagy activation. POLG CPEO 08/18/2025 Disputed 7.0 6.0 1.0 1 The curated POLG CAG/polyglutamine repeat has disputed relevance to CPEO. The provided sources evaluate the repeat primarily as a modifier/association signal in Parkinson disease and Friedreich ataxia, and note that pathogenic POLG coding variants can cause progressive external ophthalmoplegia; they do not provide direct evidence that POLG CAG-repeat variation causes CPEO. PPP2R2B SCA12 AD 08/11/2025 Moderate 8.5 7.0 1.5 3 24.58 Spinocerebellar ataxia 12 (SCA12) is an autosomal dominant repeat expansion disorder associated with a CAG repeat expansion in the 5′ region/promoter of PPP2R2B. Reported families support segregation of expanded alleles with an adult-onset phenotype that often begins with coarse action tremor of the hands/head and later develops cerebellar ataxia; incomplete/age-dependent penetrance has been reported. The locus is rare globally but enriched in a northern Indian founder population. PPP2R2B encodes the brain-enriched PP2A-PR55β regulatory subunit; the pathogenic mechanism is still incompletely established, with proposed regulatory effects and possible gain-of-function/RAN-translation mechanisms. -PRDM12 HSAN VIII AR 08/14/2025 Moderate 11.0 5.0 6 1 Homozygous PRDM12 polyalanine repeat expansions were reported in two unrelated families with autosomal recessive congenital insensitivity to pain / HSAN-VIII. The TR-specific genetic evidence includes a 19-alanine expansion in family A and an 18-alanine expansion in family J, both exceeding the maximum 14-alanine tract observed in the tested general population. Experimental evidence supports PRDM12 function in nociceptor development and epigenetic regulation, including DRG/nociceptor expression, patient sensory fiber loss, polyalanine-mutant aggregation in transfected cells, and Xenopus sensory placode defects after Prdm12 knockdown. The relationship is currently Moderate, based on one publication without independent replication over time. +PRDM12 HSAN-VIII AR 08/14/2025 Moderate 11.0 5.0 6 1 Homozygous PRDM12 polyalanine repeat expansions were reported in two unrelated families with autosomal recessive congenital insensitivity to pain / HSAN-VIII. The TR-specific genetic evidence includes a 19-alanine expansion in family A and an 18-alanine expansion in family J, both exceeding the maximum 14-alanine tract observed in the tested general population. Experimental evidence supports PRDM12 function in nociceptor development and epigenetic regulation, including DRG/nociceptor expression, patient sensory fiber loss, polyalanine-mutant aggregation in transfected cells, and Xenopus sensory placode defects after Prdm12 knockdown. The relationship is currently Moderate, based on one publication without independent replication over time. PRNP CJD AD 08/14/2025 Moderate 8.5 7.5 1.0 4 34.09 PRNP octapeptide repeat insertions (OPRIs) in the exon 2/N-terminal coding repeat region are associated with autosomal dominant genetic Creutzfeldt-Jakob disease/inherited prion disease. Uploaded sources describe the normal five-octapeptide repeat structure, familial CJD/CJD-GSS cases with expanded alleles, published OPRI genetic CJD case summaries across 1–7 additional repeats, and newer 5-OPRI reports with atypical frontotemporal dementia-like or Huntington disease-like presentations. RAI1 FAME8 AD 08/14/2025 Limited 1.5 1.5 0.0 2 0.45 FAME8 is an autosomal dominant benign adult familial myoclonic epilepsy caused by an intronic RAI1 TTTTA repeat expansion followed by TTTCA repeat insertion. The locus was reported in a large Malian family, where the expansion co-segregated with disease in affected relatives and TTTCA insertions were absent from Malian controls. RAI1 blood RNA studies did not show altered expression, suggesting RAI1 haploinsufficiency is unlikely; the disease mechanism remains uncertain and likely repeat-dependent. RAPGEF2 FAME7 AD 08/14/2025 Limited 3 3 0 2 0.91 Intronic TTTCA repeat expansions in RAPGEF2 have been reported in autosomal dominant familial adult myoclonic epilepsy/familial cortical myoclonic tremor with epilepsy (FAME7/BAFME7/FCMTE). Evidence includes one Japanese BAFME family (F8241) with a RAPGEF2 intron 14 TTTCA expansion confirmed by WGS, RP-PCR and Southern blot, and one Chinese FCMTE family with RAPGEF2 TTTCA expansion detected by RP-PCR. Expanded TTTCA repeats in RAPGEF2 were absent from tested controls, but no RAPGEF2-specific experimental evidence has been reported; current classification remains Limited. diff --git a/data/plots/path-size.json b/data/plots/path-size.json index 8349a960..22cd84c4 100644 --- a/data/plots/path-size.json +++ b/data/plots/path-size.json @@ -13,7 +13,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 110, 66, 198, 0, 143, 99, 54, 54, 0, 51, 780, 25, 513, 51, 51, 105, 117, 149, 0, 0, 39, 0, 12, 30, 123, 222, 60, 0, 220, 96, 179, 95, 59, 105, 60, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 42, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -29,7 +29,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 4085, 3804, 0, 0, 246, 0, 945, 0, 0, 129, 0, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 0, 60, 0, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 15, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -45,7 +45,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 18500, 11100, 1287, 1925, 705, 2460, 11750, 2268, 1420, 0, 294, 0, 1851, 0, 99, 5397, 5397, 12, 3250, 17875, 1617, 820, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 195, 273, 114, 3687, 18, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -1215,7 +1215,7 @@ "mode": "lines", "showlegend": false, "x": [42, 54], - "y": ["HSAN VIII", "HSAN VIII"], + "y": ["HSAN-VIII", "HSAN-VIII"], "type": "scatter" }, { @@ -1944,7 +1944,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "tickvals": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "title": { "text": "Disease" From 621e3e7c38ae92a5e99e93ad8982a86523b000f7 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Sat, 3 Oct 2026 18:43:12 -0600 Subject: [PATCH 15/18] rename ALS1_NIPA1 -> ALS_NIPA1 --- data/STRchive-loci.json | 8 ++++---- data/criTRia-curations.json | 4 ++-- 2 files changed, 6 insertions(+), 6 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index b9d6aae9..7a1a73d8 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -3369,8 +3369,8 @@ "additional_literature": ["pmid:41091881"] }, { - "id": "ALS1_NIPA1", - "disease_id": "ALS1", + "id": "ALS_NIPA1", + "disease_id": "ALS", "gene": "NIPA1", "evidence": ["Disputed"], "chrom": "chr15", @@ -3392,7 +3392,7 @@ "age_onset_max": 77.0, "typ_age_onset_min": 44.0, "typ_age_onset_max": 60.0, - "details": "Allelic ranges taken from STRipy based on primary literature [@stripy:NIPA1]. Currently proposed as a modifier for ALS [@pmid:31286297]. Note: the motif for this locus is CGG in hg38 and T2T reference genomes, while in hg19, the motif is the reverse complement CCG because it is on the negative strand. GCA, GCT, and GCC interruptions have been reported [@pmid:40585427]. However, this association is disputed: a Project MinE case-control analysis found expanded alleles at similar frequencies in ALS cases and controls (4.6% each), with no significant ALS susceptibility association and only a nominal survival effect [@pmid:31286297]. See the criTRia curation for full evidence details [@url:https://strchive.org/critria/ALS1_NIPA1].", + "details": "Allelic ranges taken from STRipy based on primary literature [@stripy:NIPA1]. Currently proposed as a modifier for ALS [@pmid:31286297]. Note: the motif for this locus is CGG in hg38 and T2T reference genomes, while in hg19, the motif is the reverse complement CCG because it is on the negative strand. GCA, GCT, and GCC interruptions have been reported [@pmid:40585427]. However, this association is disputed: a Project MinE case-control analysis found expanded alleles at similar frequencies in ALS cases and controls (4.6% each), with no significant ALS susceptibility association and only a nominal survival effect [@pmid:31286297]. See the criTRia curation for full evidence details.", "detection": null, "mechanism": null, "mechanism_detail": null, @@ -3433,7 +3433,7 @@ "webstr_hg19": [], "locus_tags": ["proposed_modifier"], "disease_tags": [], - "references": ["pmid:26777436", "pmid:22378146", "stripy:NIPA1", "pmid:31286297", "pmid:40585427", "url:https://strchive.org/critria/ALS1_NIPA1", "pmid:30342764", "pmid:34179866", "omim:105400"], + "references": ["pmid:26777436", "pmid:22378146", "stripy:NIPA1", "pmid:31286297", "pmid:40585427", "pmid:30342764", "pmid:34179866", "omim:105400"], "additional_literature": ["pmid:41426430", "pmid:38667292", "pmid:37043475", "pmid:35869263", "pmid:33414559", "pmid:32954321", "pmid:24866401", "pmid:21419568", "pmid:11839840", "pmid:10987648", "pmid:9736780"] }, { diff --git a/data/criTRia-curations.json b/data/criTRia-curations.json index 7ed8dd97..56b08ad6 100644 --- a/data/criTRia-curations.json +++ b/data/criTRia-curations.json @@ -3857,9 +3857,9 @@ "classification": "Limited" }, { - "Disease_ID": "ALS1", + "Disease_ID": "ALS", "Gene": "NIPA1", - "Locus_ID": "ALS1_NIPA1", + "Locus_ID": "ALS_NIPA1", "Inheritance": "AD", "Curator": "Harriet Dashnow", "Contributors": "Macayla Weiner, Laurel Hiatt", From 2b828354e8b5d784627c53c84a1f5078a109ce12 Mon Sep 17 00:00:00 2001 From: hdashnow <3794821+hdashnow@users.noreply.github.com> Date: Sun, 4 Oct 2026 00:51:56 +0000 Subject: [PATCH 16/18] Update data --- .../STRchive-disease-loci.T2T-chm13.TRGT.bed | 2 +- ...STRchive-disease-loci.T2T-chm13.atarva.bed | 2 +- ...chive-disease-loci.T2T-chm13.atarva.bed.gz | Bin 1881 -> 1881 bytes ...e-disease-loci.T2T-chm13.atarva.bed.gz.tbi | Bin 4479 -> 4483 bytes ...isease-loci.T2T-chm13.expansionhunter.json | 2 +- ...TRchive-disease-loci.T2T-chm13.general.bed | 2 +- ...STRchive-disease-loci.T2T-chm13.longTR.bed | 2 +- ...TRchive-disease-loci.T2T-chm13.straglr.bed | 2 +- ...chive-disease-loci.T2T-chm13.stranger.json | 4 ++-- ...STRchive-disease-loci.T2T-chm13.strkit.bed | 2 +- .../STRchive-disease-loci.T2T-chm13.ucsc.bb | Bin 45172 -> 45171 bytes .../STRchive-disease-loci.T2T-chm13.ucsc.bed | 2 +- .../STRchive-disease-loci.hg19.TRGT.bed | 2 +- .../STRchive-disease-loci.hg19.atarva.bed | 2 +- .../STRchive-disease-loci.hg19.atarva.bed.gz | Bin 1900 -> 1901 bytes ...Rchive-disease-loci.hg19.atarva.bed.gz.tbi | Bin 4466 -> 4466 bytes ...ive-disease-loci.hg19.expansionhunter.json | 2 +- .../STRchive-disease-loci.hg19.general.bed | 2 +- .../STRchive-disease-loci.hg19.longTR.bed | 2 +- .../STRchive-disease-loci.hg19.straglr.bed | 2 +- .../STRchive-disease-loci.hg19.stranger.json | 4 ++-- .../STRchive-disease-loci.hg19.strkit.bed | 2 +- .../STRchive-disease-loci.hg19.ucsc.bb | Bin 45062 -> 45061 bytes .../STRchive-disease-loci.hg19.ucsc.bed | 2 +- .../STRchive-disease-loci.hg38.TRGT.bed | 2 +- .../STRchive-disease-loci.hg38.atarva.bed | 2 +- .../STRchive-disease-loci.hg38.atarva.bed.gz | Bin 1884 -> 1885 bytes ...Rchive-disease-loci.hg38.atarva.bed.gz.tbi | Bin 4458 -> 4455 bytes ...ive-disease-loci.hg38.expansionhunter.json | 2 +- .../STRchive-disease-loci.hg38.general.bed | 2 +- .../STRchive-disease-loci.hg38.longTR.bed | 2 +- .../STRchive-disease-loci.hg38.straglr.bed | 2 +- .../STRchive-disease-loci.hg38.stranger.json | 4 ++-- .../STRchive-disease-loci.hg38.strkit.bed | 2 +- .../STRchive-disease-loci.hg38.ucsc.bb | Bin 45249 -> 45249 bytes .../STRchive-disease-loci.hg38.ucsc.bed | 2 +- data/criTRia-curations.tsv | 2 +- data/plots/age-onset.json | 18 +++++++++--------- data/plots/path-size.json | 10 +++++----- data/ref-alleles/ref-alleles.T2T-chm13.txt | 2 +- data/ref-alleles/ref-alleles.hg19.txt | 2 +- data/ref-alleles/ref-alleles.hg38.txt | 2 +- 42 files changed, 48 insertions(+), 48 deletions(-) diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed index 957a8d96..e3a4533e 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed @@ -45,7 +45,7 @@ chr13 99196358 99196404 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC= chr13 101377549 101377792 ID=SCA27B_FGF14;MOTIFS=AAG,GAA,AGG,CAG;STRUC= chr14 17522488 17522519 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC= chr14 86300519 86300603 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC= -chr15 20458510 20458536 ID=ALS1_NIPA1;MOTIFS=CGG;STRUC= +chr15 20458510 20458536 ID=ALS_NIPA1;MOTIFS=CGG;STRUC= chr15 32225152 32225178 ID=aFTLD-U_GOLGA8A;MOTIFS=CT,TTTC,CCTT,CCCTCT;STRUC= chr15 86324038 86324057 ID=CHNG3_MIR7-2;MOTIFS=GTTT,TTTG;STRUC= chr15 87088402 87088452 ID=CPEO_POLG;MOTIFS=GCT,GTT,CTG;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed index a5f610d7..da5aaa05 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed @@ -53,7 +53,7 @@ chr13 99196358 99196404 GCN 3 HPE5_ZIC2 chr13 101377549 101377792 AAG 3 SCA27B_FGF14 chr14 17522488 17522519 GCN 3 OPMD_PABPN1 chr14 86300519 86300603 CTG 3 SCA3_ATXN3 -chr15 20458510 20458536 CGG 3 ALS1_NIPA1 +chr15 20458510 20458536 CGG 3 ALS_NIPA1 chr15 32225152 32225178 CT 2 aFTLD-U_GOLGA8A chr15 86324038 86324057 GTTT 4 CHNG3_MIR7-2 chr15 87088402 87088408 GCT 3 CPEO_POLG_flank diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz index 3c12ee20029c32632a33bf74966d296869ef1171..bd99b1dbd9069f102adb0e82d5f96fa5c1efc2a8 100644 GIT binary patch delta 1390 zcmV-!1(EvM4%rT{;sJlRvRu}&%?vQr3Jnbq2QdS|@27m7K7B3ec1^*BAv?>Y6}tgO zAmyAvLp(2u%Y3=ZC)!<6&S^zEI7l%ALtKxyvfi%gZ3fIs>VQ~F{y#S207L&(^mN!od(pTG)o&M|<2Q<#soh7%%uMB^rIusc!#P#c3^7nZgnla)$F%NKVjKt{}CoVaj`fl)`wbz7HpTe4; zhR_g0ZF)|r2HlWyebk?Gh#`d*c5{rm)?M41atAu8#zj*#yGohP)c2518@ z)x~?9X8g2nA)ZUT&FelG&Ug{t!Pq@Q&se5;{ZcgoZ$+^cy@NnKEYp~2Dq9ZsNxF+l z8Ozq0LG2ifBbZYt;dJ6*iZu>V{2-z|+HLEE<$QZgxT_x7dha@kQqP5+rZuFJu3Hlo zkadjCwe*8tS$gSre*uLSQ>4 z87zBaS`F#!Eq)@W;%i8~n$ORACoupYN^x;?HmOlJ+DD0-6p5F~Z^ehhhQwgy(h z^~`^5Pq(KZ=c$}?elzMsDd8HS`%rb`)j|#I867h1U~6*Fj*u9ZZ(%FA+o;GAed)J{|2ih#fIF z|H{)Plpo7Udc<~s$_QFrlcP>G`F{>Qmg{{*8Y+724Qtt{W)k%}Hr5K3EzDE5J&+iu zmE{g-YP^WG6&6l;3fB!w^#A$mPZ@r_V<}hjhz2!g0mA7%g>rfrj29a){T^kJSgX`>a^oq24R|Y_9jbm2iK&Sn?67?mU%gp5CPTUk8Jb0e9s!!Vj>H!^63tko;(^_&k;TRG&POOL?el9+v>QEsTrX4E wZjW8m7RA;scM|(twR8z^*U>C@MeZr2oC7_zfWTCp2o z1X9i!G{p0gxXhQke4^bI<(yWugM$<^FvRtEE9>o=-lo93qz;I++`|Qj>QHH^%ejH!x~^jlY&F`&m>Xvx1^2ja<#;*i z(5rFasBYi-@XCKcszZ^%LR`PjC4Zl{p&2926Y~J)#z>rwapIEWsc#1lT6;}M^(m|g zY77lA)TZZ@YSaxW*GK(1hZs_5aW}`9Yu&ZIDd&(Gra%HTcB z_pfXCR@Uof*;|6l%*b}YbD*~vY>6Q*0mH6pOJt21;OT$u7^0Fc>xlUt(0M}3YJfHn zQ(e5rX~s|M7UH?Y+q~|B;fxpI9gN*W^o(Vi*DqBg@KzLC(K`s#(=v^jrn2R5pQO8} zl(B4`8Pv|fIHEa)5>6)`rdZ<;#SbFd!`-${SkAY{guCjIt@o~zDD_AE#h z0a?fBe0zTqt2Vnifo*%omgTk@`=(Z7{Hp@=vw-$0f+l2AMi1~^lipl73v8`RF` zu-7gn_eCv0!fdS59fZ`FtMe(X8OKSM$5tO=DF}=+%D! z_OC=;Liw?rq(^KAsEnZ1H96{3v;XJNW4Yc}q@kkM-msRPY9>+dV`Hsg*}^<^+XIPl zT3POZrpAj{TVdgpr2dY^yhy}hUnIm2yfS8C;^*gvUdKrPcq{nD3PUzlLN zP2XLK$99!^0D2?rhzAJ14%J60hjcz6p=6cUt3HQgF<=n75?{j{< z9FO?YSUE@az;7VB?&6l>&QqD@=}oHtbub7Sa93U<`~Yjb7}U~%jM|s^VGd#?+=t|y z6ExhR9?&7R;AP=4ttE#Ojv-;=#ER%a?s;AM7Ggf$uaA0V;$3#GZf)L4yV2vv^)i+1 w_Si*jQEcsUC$Y~({@BWCzT?vqYtXAfHI;l#$+6}+^xJ;{asMmJnUgvPAMa|?(*OVf diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz.tbi b/data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz.tbi index 1c7e7e9dbebc9f5df2adda3358e4b862600e40f4..ace947e89605e578c1a97b33b9ec3047e6baf65b 100644 GIT binary patch delta 1862 zcmYjRdsLFy76-&M4aB0-%(VQ{93Ru%88u@Pe3a6dk4eLo)EFE~@@0=;C5E!!q+9f32(JlH{_p)}(yH)5WlU+?>YSX8{9Q$p~&HSo2&oZh=c zVp?1Vh-`qk;LZqQ(xbc;)O*lCJyZ~oM7eGy4--{L78j1AMAL0!&pLKMvhdn5{`g>> zxWTeUI$qNnwT9Kg|5_ftfyRHE?DH@ISPr*M@yOzw-%Jh>nj}{hELFZsdEcwD$8+Uj z4L41WYvy8FSlku-5@&2dqv*NzIh8~AwR<2CtCHs^;zKNa;40_PH}Z~23HehDtueFY||S{T${o|C<8cM$<149+ArP7Zg(zI*8D92-vo+r{2U$Mok#nK>jiy@~!ZBXJh@*Z^m0 zYSL!N29$!Rg1mu|ya1nv-!~0W(od#GQG6Vk(9Js;txnu-2|j{5xRB_+dp#wv4Zb7D zUu8PqD4Ge*r=m%eyY%bIeTxVA$}kr}QjubKAucMVNks}{-V#JakDK4&2S4K9qL*@aHmYrx zXwh<>$?Wpkxb#xFK=<-4lS=dTq;&Se>Id}5cW5)6NZ<~`P5Ng63_TBYFg%Uish9I^ zO}l8gY}6^h+Y_rlvG@a#MF{dEzz|>MB7>hHQUS-Z>vekRK{=WEb+Aou2{DC^i21QU z9vN*mtay{r!*MS@*HO?yTp0bv?_-7N!fJZl{&ABjcAb*wZ}%4e4+Q9PJ7SumCW;=ImnaKVnbnyx>obHu&YSb@{dM(6wwYtx`vz?Xf&hO{RCe>)L9&X8s zjA|t&TvE(EIn!_{Rs3&eae%EubCP=D|ouB{__Ll#O(O&^ZP^1-S+g)Wej(|stXsdSs8xF0gSY* zkfhQ_xm`i635qd7p^w>nAIfwbrV?l!drgN^V=o8b?5-JLI|v`tcf%nNRI zcyjTIt9tL)zfLK#vkT>}WNM&DUg0;^!2-`9tPY${8;4$< za}xQJWEIc_jr8upQ;>B3P(qvh=kG!#7a%Duq6^|yL$WZZn({rCYqsvaP3TSaajKwx2ES+9$4cWHHt8Vp7d^pr0wvkwBy*KtfuFU9Y8LZ`rbrp&WkRG|4t^F9?vhX`2fR-X!BI(;JtUft7cB87(cDO)r|J39 z^cpDiIB6w%sLHuA>1yjT`L@_!bW*6|Ki?xPhNQ2{j?i4gNR~Wk(7IWtxNJNE3P-LJW1_FYyLd(eGCm*q5Abbl2gaE+?6-NQd z>)ZAx7G(_b)2!=*Olt?R|Bu(hB^sTqvy63KY_St8jyC2I| zyR*3;#f*zx>o7=k=tqthmHb5NL{j``qEk-yVVlB`1Y?r1v-yj^o1;Y;H+RcCmCHSF z>X+q2Dw{|>>~97;@)GL{O2JI`5Q&(oxV`vX4L@sRL>IuEu5Ky+U6{`uLZf7LY0NT& z(f%c`E5-zh-|vb4C7pEJpH1^KJEzCWkyH zQ>p1$s@Pwq2*-a{wrXXXk&~0co*RpC3kQ_*-~ATCU=FDR_%fyJSM3k9U)65itDkKY z(cz1t9vsz&kvV}IyQu<%0ogbi+K;f<_YhDFdSH+U3t#czU3+WJ_jgS=1L&P!c=0c$ z72;7};147JYgZ+$njJbW$pj%hVw?Z$xBzng+Czu7xOHKp10pruZeL^n_ZQ^{LnO&f zFy}#K)}8t~-ek^+D;;WQGB<|2QC^=i{OGc-;k`zh3uZU*tB{@w6GSK`90Ps4aYoae zhZKqvE)7Ms?gQD^tnp#KgiF0?z#$~+AGU9Cd$5HG-@Mq2IZZp)W{dC3HEA2MP? zrG}P)b*$oZ&r($NcC7m$m7zDvoO!C7OfaL-FT93C9*u9D;C0DW-H#SmhMn>!l5-S| zN_DQ3rE6YX`lk}i2J>{pDA`*lJnt{%;*b3b9u@d@SI@4>|9RWRu}qb}bpPer+vYjf zA9?^C4MAul`e7)Qmr5IC{Q!It(=}t8-iIlIYNCqu-LV4%-H`VmWzW9Y|CBm%a*&@OmAW;A zECd))*;S!~SBX!vj%`m*9H*vdvx6P94R4%8zc3R$c_Unbco7S=APCIyNIrGTy`_ad zYU`!6(Q}Ll+1y%lyD+W0B720}U)v=dcTip8>!99O*J)Q%b?w8AHCNhtsJR=>9taoE zI$zmnlE#IwYPtR}*`+61n)9j9r9$v?T%c$*K{^;W5i_}0rF5(i5I5;yUB^=0+B@y^ z8d_Zk6azL0zy<(XTD3uYeU9Zm1X$ilXF-(%bRM$@3f<(1GM~Y5^@pA3bmnMDpu_@4 z{->ghyb}%|XlVVWC~4Yabf0apkK3i&pM|gF;(dF@@`gOYRj@p-bT{-Ba)*0fhK^cx zfaDNNcZTVVrZV{tFx=niI;hq@Zkx}lg%3+zNGmzPk`-RvfYJ$;uQ0T1;?!WyHNC;m zvx!|cqOBSJdMu;7Csu&kHdoJwGy*8@_hAqSz*j8nylorM$#3xb*gg%s=AvKF1tgam}FGkb3mX!0F7g|Vr7=@$O|5BC{wR{78Xqq0^5xm zJ5+rO>cbK(CM1L_;h?UAM zUw4@g2dSNk9dZF2am(g4010}XYP(VGDQw|xG{w!d@O4C7Mg6NY*Lg6x^2qx? zOP*&L6pM6VF0vSYY~@ci5^-P&J&_BueuPs(UEszBIHeBmT8*mhnrwo1oB;D~&KQ`O*+;E+zJSA^QSxHj oZx6`hAp?9Qk!HFy|F{JJc3eTD0R5vi1Smd8zzQ%}5A~lv0OqA`ZU6uP diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json index 6e762c06..456947e0 100755 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json @@ -282,7 +282,7 @@ "VariantType": "Repeat" }, { - "LocusId": "ALS1_NIPA1", + "LocusId": "ALS_NIPA1", "LocusStructure": "(CGG)*", "ReferenceRegion": "chr15:20458510-20458536", "VariantType": "Repeat" diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed index 9f2e7418..55a8e76f 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed @@ -46,7 +46,7 @@ chr13 99196358 99196404 HPE5_ZIC2 ZIC2 GCN GCN 25 AD Holoprosencephaly-5 chr13 101377549 101377792 SCA27B_FGF14 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B chr14 17522488 17522519 OPMD_PABPN1 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy chr14 86300519 86300603 SCA3_ATXN3 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease -chr15 20458510 20458536 ALS1_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis +chr15 20458510 20458536 ALS_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis chr15 32225152 32225178 aFTLD-U_GOLGA8A GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U) chr15 86324038 86324057 CHNG3_MIR7-2 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3 chr15 87088411 87088452 CPEO_POLG POLG CTG CTG None Progressive external ophthalmoplegia, Parkinson's disease diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed index 07a30d6b..0a9dd024 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed @@ -45,7 +45,7 @@ chr13 99196359 99196404 GCN HPE5_ZIC2 chr13 101377550 101377792 AAG,AGG,CAG,GAA SCA27B_FGF14 chr14 17522489 17522519 GCN OPMD_PABPN1 chr14 86300520 86300603 CTG SCA3_ATXN3 -chr15 20458511 20458536 CGG ALS1_NIPA1 +chr15 20458511 20458536 CGG ALS_NIPA1 chr15 32225153 32225178 CT,CCTT,CCCTCT,TTTC aFTLD-U_GOLGA8A chr15 86324039 86324057 GTTT,TTTG CHNG3_MIR7-2 chr15 87088412 87088452 CTG CPEO_POLG diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed index b09d21b9..09cc75ca 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed @@ -50,7 +50,7 @@ chr13 99196358 99196404 GCN HPE5_ZIC2 HPE5_ZIC2 chr13 101377549 101377792 AAG SCA27B_FGF14 SCA27B_FGF14 chr14 17522488 17522519 GCN OPMD_PABPN1 OPMD_PABPN1 chr14 86300519 86300603 CTG SCA3_ATXN3 SCA3_ATXN3 -chr15 20458510 20458536 CGG ALS1_NIPA1 ALS1_NIPA1 +chr15 20458510 20458536 CGG ALS_NIPA1 ALS_NIPA1 chr15 32225152 32225178 CT aFTLD-U_GOLGA8A aFTLD-U_GOLGA8A chr15 86324038 86324057 GTTT CHNG3_MIR7-2 CHNG3_MIR7-2 chr15 87088402 87088408 GCT CPEO_POLG CPEO_POLG_GCT diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json index 1d4c4bce..85bd4368 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json @@ -611,14 +611,14 @@ "Gene": "ATXN3" }, { - "LocusId": "ALS1_NIPA1", + "LocusId": "ALS_NIPA1", "ReferenceRegion": "chr15:20458510-20458536", "LocusStructure": "(CGG)*", "VariantType": "Repeat", "HGNCId": null, "InheritanceMode": ["AD"], "DisplayRU": "CGG", - "Disease": "ALS1", + "Disease": "ALS", "NormalMax": 10, "PathologicMin": 11, "Gene": "NIPA1" diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed index 6bfeafb5..36230d60 100755 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed @@ -45,7 +45,7 @@ chr13 99196358 99196404 ID=HPE5_ZIC2;MOTIF=GCN chr13 101377549 101377792 ID=SCA27B_FGF14;MOTIF=AAG chr14 17522488 17522519 ID=OPMD_PABPN1;MOTIF=GCN chr14 86300519 86300603 ID=SCA3_ATXN3;MOTIF=CTG -chr15 20458510 20458536 ID=ALS1_NIPA1;MOTIF=CGG +chr15 20458510 20458536 ID=ALS_NIPA1;MOTIF=CGG chr15 32225152 32225178 ID=aFTLD-U_GOLGA8A;MOTIF=CT chr15 86324038 86324057 ID=CHNG3_MIR7-2;MOTIF=GTTT chr15 87088411 87088452 ID=CPEO_POLG;MOTIF=CTG diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bb b/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bb index 92f8808408e4442700fb00c976a7ac13ce7214fe..c8124568f36e8a6ed0e64ef6fdf4815604ab1292 100644 GIT binary patch delta 842 zcmezJfa&uCrU?>^eiJ42gRE>Bz#z^ELYpu_=vh$^S}GnwU*LeyVdW5dQ#FKkP=?U& zCPQfB8Iu#$r)@T1ERd}C&bw_OQX7%w>&fZE{W%cc|zqI_BK0K6h zsu%lg@xfi_Z08R-S&NKII?@6x6Lb`BzTIlPYwgCA-hxXVZ8tYfbc^1yq2A?onO~l| zddl}-&;P#YRnY6cTJ$S>^4&F?TGUglS~YkMTXYD)z#nK?sFgBwrNt=C5tOvf8D}2zmuD9RkA|k>9mDfv(H^xo|>M# zVEqK?zde5!XS5xee)0KZYo}kyb6sb@u3tUBJJaIG)6W`nehSKa?rHdWhWlBq=i;tK zX%jB;2F72GTJ5DQdNndkXgZf{>e}yX%f8;rxU=Z4uksGn&Q)xm{p0<#wlcK>Bk#514-87R-D{4kB?KD$fI?O+RWdfar;S z9t@l1!4gRfAD{}jfON}b7X}dhr|T)xVg-oAbEpIOfZYGF#*85PnC>B_E+vS(JXD?+ z$PIhc!~~+Nf%Hmfa$LGOQT>+a#0{*Qt!-Uc8RI55I4N`4LDRYdD_C}Ofw~CO=GjpT zSeT^ZCpS7NG0xkZ5MM0Aw5b}z^{u3qjgRE^Cz#!fULYpu_=-E*aS~?y=U*Ley;pGr|b2Wr^P=?U& zCqrnH8Iu#$r)@T1ERd{s%)4zMP{PN#VS3#H@wl#KD`Yw*rEYe2%)7#{PTAy@qI&a0 z$;`l+A)Z>j`L*u$m#%+d{p%9Gsi{dK$$`&c^JekQH{XORoYUic`K<5#HgnfgiY?y- zTDx6TZ030EQ4wM*d9dW$6V@r(%Jgnumc1cq?Uz%hrtMr6dd;F_L%rMeuW@hF z#h-lt{Qdssc$Ui8ylbD=@BULZdAXA6Wy>RhBC0l>YMX=(C=2>Dh^IzQlT1@Q-o-_ZNY|r)-^Lx9(l+e_U_5 z!}|pro^iIj-|XvL|JeNb_m(%8&HBsd*XQqB^X#HTxX$AY!DC5EC%L9|H|V!dQWJGO ztGHbH(ZXeGFK%_zT2;PAX`M;csarDEk7qA7-Qiw7<9LC)P;CFR_5WL*XFG+}?71s? z<-o~GQLc>(-ubskRo^_Paq^V#x&(=3+fG^51o_xrPRr18>;BZ6!@n#$wAU!1b<6z# z>&5r^tlT80l)Ub_cKDGiycUbZscMF(F}=GS+!*# z;uoOupjZ!l&Bq9$->tvG@>>=n{|G`ca02Pi?L1)mgrb8S E0I5|ZH~;_u diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed index 52eac247..91b66d39 100755 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed @@ -45,7 +45,7 @@ chr13 99196358 99196404 HPE5_ZIC2 0 + 99196358 99196404 0,128,0 ZIC2 GCN GCN 25 chr13 101377549 101377792 SCA27B_FGF14 0 - 101377549 101377792 0,128,0 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B Definitive chr14 17522488 17522519 OPMD_PABPN1 0 + 17522488 17522519 0,128,0 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy Definitive chr14 86300519 86300603 SCA3_ATXN3 0 - 86300519 86300603 0,128,0 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease Definitive -chr15 20458510 20458536 ALS1_NIPA1 0 + 20458510 20458536 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed +chr15 20458510 20458536 ALS_NIPA1 0 + 20458510 20458536 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed chr15 32225152 32225178 aFTLD-U_GOLGA8A 0 - 32225152 32225178 128,128,128 GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U) Provisional chr15 86324038 86324057 CHNG3_MIR7-2 0 - 86324038 86324057 64,160,0 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3 Strong chr15 87088411 87088452 CPEO_POLG 0 - 87088411 87088452 200,0,0 POLG CTG CTG . Progressive external ophthalmoplegia, Parkinson's disease Disputed diff --git a/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed b/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed index 5967f183..3123aff3 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.TRGT.bed @@ -45,7 +45,7 @@ chr13 100637702 100637748 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC= chr13 102813924 102814076 ID=SCA27B_FGF14;MOTIFS=AAG,GAA,AGG,CAG;STRUC= chr14 23790681 23790712 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC= chr14 92537354 92537396 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC= -chr15 23086363 23086389 ID=ALS1_NIPA1;MOTIFS=CGG;STRUC= +chr15 23086363 23086389 ID=ALS_NIPA1;MOTIFS=CGG;STRUC= chr15 34711626 34711652 ID=aFTLD-U_GOLGA8A;MOTIFS=CT,TTTC,CCTT,CCCTCT;STRUC= chr15 89112664 89112683 ID=CHNG3_MIR7-2;MOTIFS=GTTT,TTTG;STRUC= chr15 89876810 89876860 ID=CPEO_POLG;MOTIFS=GCT,GTT,CTG;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed index 5ddc8d9b..4e11131e 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed @@ -53,7 +53,7 @@ chr13 100637702 100637748 GCN 3 HPE5_ZIC2 chr13 102813924 102814076 AAG 3 SCA27B_FGF14 chr14 23790681 23790712 GCN 3 OPMD_PABPN1 chr14 92537354 92537396 CTG 3 SCA3_ATXN3 -chr15 23086363 23086389 CGG 3 ALS1_NIPA1 +chr15 23086363 23086389 CGG 3 ALS_NIPA1 chr15 34711626 34711652 CT 2 aFTLD-U_GOLGA8A chr15 89112664 89112683 GTTT 4 CHNG3_MIR7-2 chr15 89876810 89876816 GCT 3 CPEO_POLG_flank diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz index 000752c7c5a6c277f1d948fcc6313e0572b8178b..2315cfe91ce37ed4f56a68dc5ad0d321f272685f 100644 GIT binary patch delta 1893 zcmV-r2b%co4($$qABzYC000000RIL6LPG)oPzQyVPtW5h5{J(<-{qC4Dxly9uoz>_sYQr4+rF_*- zEPqU4icfWl<=-?Vun1vDUxqw?Mm%m}jYVVRATjMGU|^Zgc?pkmH5E8C&LaB`R`s^u z*ZGEd`Ajo^oj$_eDn>x`O04(3ktpVV!LO%1$J4EP1fsNY;%n*IK@7ziw)GZrNDFq& zDCeCx-M}g7m5p0K3VFD$bm}T1DYjy`lOu+hioC}_Ii$xzhe}$ZBP$1ac|O%J>%3iW z>+NU)G8rw(`c7zUZ|xpKKCfD-YBGotWbI4?g9c)M3e9u%{_ei#KmPUGzyJAuLGc<` zd^PxaL03^J%OZ*n(hjD$0K;WHoBaJ6>1mQf_M{tWB^JWbUXoKDrxA6PH4uwe)?oud z>XqKtdB|%xt-U8Scrq+y=r-{7)mE-;ZKK@)v2vCzcW}PH+Hl+Ra$WmGGr(F9E!hr+ zASNJx_-#zL;o~z;_uCX)=(6*OWUcPt7^ajGXo#0(;yhnB`Jkuk#JVzc8(5fP0*1Jr z?|Hr7rnf#YFR6nsHUB@`cd+Vz>#m*!6l1km-9bD|F_r;-`rAPH@$Htdo1`sir+f#) zkWz{P42)qu+nkmy+R$Zd4QcYe0b36tq&jPVOE+LXox^feY{iKcYZ{b_pQF}bPM5Ia zp$a)d*XUb1iic{li1KyoD=v zRUDFX$~7oaP|_==8h0_K$_Yrp7S}zWucHp_HV&+{&LdbWmI*t))w|Vb> znqe}`B}5A75@GdCjORFTPH}9r!GkuagloxG5K4%K7)sOAG?my5Qz}LIIfWReP=hzc zn999Nd#9AbG=*xW6nY4k3u-E-@C8gEB9lv(4rh z;u0_%sk#GXy7tibfX;b;>$L7rqr42>^DyJbx`%kl@jkD|%djM@Ej2Kt zkBpu%5A*t^XauDma!MZ{P?pQ7_cY}_g>8`LqEbRgRvqMQZ|k@P3OS4;cT=o4BF=Vl zj6In4b-;YNKL$KhkD`t7u9MYAJWsn$%;IXP71!QP6WBU;Y+mkvtFdot zQEEvD@h9pl7f6A&PARml)C^_dhUdDRo=bIU841K+hrDjf`qw%%*Rm|QwT|?&3iPvr zdMTCx>uuR#G^jlr`@W#;a|q7sj5+SGZ&^u@hu+(tzEu z$vLlcj{EWj&t23OJre5%tTdE=Y18*jsOk!Vb)jS^i-IeSY~b;gOj1R8_sRq>Q2OH; zOWk|DKL#Y{JnAye8+l*qoj^mG2yr>BKZyPi4OcO|iGQuPNS#C=2B4qI?5x$!VkfUO zEK^DT(|X?Xcz@ien~pUrh3ZK^hNRBl&LQp9*1$@vRoqH*OvTHPFDbo$8CJE@9}}w? zuNG=x&qgWl8=&H{IjBoW49nNB=WT3(p+Tc)@y=IpO8fpOF<$n(Uha>!_tJn?k!7)b zkfm*8YBP=T#*pU*TweUKQB#_F1tdAAUdzgo2dmu5w+ED|eHN<)z0t;gr!fnSK{eS-aL%J_z z*NM(HAVm-WVcdq0$H(&OE&mc4kSeFb`f$x{7BU-Sy{AT^$Q{#g56j2b>-Cz~ZJ3Yt zA{(!*DI=?pAnCe)DAmtYcR+QgF||`)s?Wj%^L_Z{ay-|w)B{K<<&{<)N}L{x>SM~M zcnfV=eE=E7SQf|zj(TsdTiSEj9&eV|ZaF*>?0h|+@ue}cA}hLq5J5_Hi#rc_n1?s1 z{MUdLB)~&?z2QgQ!x=QL0omu8aGFC7Ta!dtp%SSL9732}YIs?A3~Nqd#3mw_6!v9# zE94cLKEJ+(n9kenQBF*J$lf@s%Za;^A={t$ak~zAzdsI9TkqMFV`C*t$Ju6l?0KBG f)*NUfUig60ll%^0vj8iJVl&|`U z<&P;$@u^O+{F|l(79kAj%aG^Kh({yVSTsfs64M$11Iv8QOL&~CslcIe7TI^Os`vfA z&Ns}yZfI1_}6d${^$Dx#cN>k z)#2v@T}7oVizqrsJDB1E443t6^7m_`r%4XklWwGySO`adNltm3M$}c-KrCKahYbX& zS9)LPA+O=I_L*t))w|Vb> znqe}`C5jZ#C5F|J7|(IwoZ{HFg9mL;3D=UXAe1N?Vklit(^TSam{KXq&nd((g&KKN zjH$F;`a7i*rYTf2rO=~rd7y^nRDP%(tq&#e9_H22WT?I5B&UDqD_d|5Gd#6)MuLVp29Xrb5SWFB&!Z`w)b`10)-sLk-I6@8xdza zImRBD_I1E~xjzOxRF9&K@vf8AM|_@!HB5QB?NwAjmYK!XQY)^rnrnhLA$1tPk>e>>2S;>iV4IGnz1M_hMIsz|DQkqknT&# zI?>q%qzD2ajN1_M_*h=E>ph!tZ>(hLxZI47J&*Ht ew64WCDzn*$gx{v*T=E?H<-gJ|8f%@CP6r>`Agt&B diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz.tbi b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz.tbi index 767084f1e8262996b532d7839435ff52f8441e3c..8c0a09f4f61557c57f202bbeface1f2dfc5e980a 100644 GIT binary patch delta 1937 zcmZWp3pkr+8%`tyzffddotn~5xmJhb3Pwx$8KJ3W^;Oa7)G#?PjINYWwdzl4eV16Z zDO+jlQ>RrNS{C-xF0E5&N}Y{H8-j_{G{lnZ>S5R3>$~3fyPxZQpYOi!?|I%8vlX+t z8nlfYQq*(cu(1a&n^*e^8Q0E8$cZG)(w*B=>rn+?)uZeIJ$w7ccFjHKk}gA6pmB8h zf5Nf+9?IjzXj@JIl&9*4zVvl~A7qEbL5r%}@W`JGAM-NxaNp=lULM4JQpfJR;WgVW z0341ItgD2cP`HYTpZg+f!_+AYAQn!38&D`;{(f%4+xhg+dlW-3$plO~F?81@PZ&AL zqR0kL`hY#DeP<*am)~s$h$~LledXx@jI2n9^Gy{}L4gs36pfo6Mv=FvO~qsmsNvAY z-<6b6w|#xC1KMMZ%$(Bn)owSxGlj6s&v@mr4`?;;BOb}g7NiQE$fQx7Bcv!Zvz?A+ zz6wSQBkY{!iHk42JE>7^9^wVJpSH~L(GvwP#L2_Ls+z?Ev9^?T*ZI-+0staJS218L zOn7*mFm7nGhI*K!!MQeOpLo$ye62hB>X5W}lR4BT43b7r@P{OQMSDu;5}Nq(i2F#$ zSMqN%x(t+V%(}-PPX2P!K_1%RYP>b*y?AbsI6|--(@W^3In%;S*sTKn$%-b6PnVoa ztE_7Th5;N&aKVd2w^#|k_RW41TgtyvJXkfk;LE?P{BefrT51hA-<`-J$V#1xUKZG7 zE8YAODH^l$Ly>W+{jNkH!V2weM6PSp8=X?=RBg`a>;-d-d}lthqIX3eFXxeRy1Fe4 zh!MJ%XIlmBtgWyEd{SX?xaSA{a3$*=?_k2b$YR~a7Y3480Jr>b;cOIhmAP_84t9;V zxF3Qm+AI_xm_2OHr6+kN%!sTvoqFa0Vtz6NR1UB<2g^hLSWIj9O;H7S#@7EkKHs9f zf>`X=gRDo;Ek^QKdTHZCV_U=EN$KPxQrIH1tz*J$_dlGd8M6Bjb1$9tQ}CO`j}a42 z^H(wMc_j-i?A4EoZ%j8i;%~WbK8f18mlm|BRdcO%Y_Bw6PMLNn*ZVV#LZIa_J}&-3 zxYAJ_O{{8AcbT36WU5I=qhp*q6k#VJLeyPPS0UrPcn_GYgrL_rD?WL4`mU9bstF#+}L%ACT??Zdyw|XE}oGJpbsl z+9g7Dg7^+R*;jHb^#K`_mX;jbvWJDz`JX)s&)Up+K)Of+Ou;l0Sn4)`>a})ZS}#VE zu6k7{C|UO_C~5qPKzQ-+?A(fMBlX5pbLg7s9kJ7%9clLGD|i}S69k?788|lL3iP9v z9f2sjcTLz*^YcDtqLazk~n_oo$}4{KBBX&u+rWH({9@6&8@KS9*L%x#MR7`J)U{ zt}H%~FI!vje_L~0>2+dZz>AWz{SLDY$IFyF{IFOQ+3R;G1WQAAHR@6nLF76#iQOKk zMk`BviPk<>|E<2}t+EWGW&no+aD7Ajx!iT1KNI2fV(+(^l~vR_;VluLxJMxb@`sLq zag&5v$0sqe{#6;CnmiDS1to6A4p6u@4n6ZHCI_lV>YH*yo1LF`7_QYeV&+IoGm)Gu z!s}<4t+2KAHw&9{gZ2J${g#;41?_7u4ZM|fhqQIgjWk9xBWb$Zm+$lX?ej#PzdijV zuk+&_J2Za1I=c^5Tsd`2bj(|R(lj_7ws^;I<>Dki<>*mD0ql|oyTnpL7K+K>TxkhB z55wv5idved#&hx>6}+HrQ9@<~WKjI(ius4#@%KA7sO@x-qUCmK{L**kDRwMy;gN#b z0SlyP#MQ=|jLVp2P=VNlKGBg=D!=oplJv6eEWz(h{ZP$=`w$UFe#k=J=_KbAE{gG`&AHf|J9x&=$sFs0>-h-aK1U}1dI zLmEdC2wuS8+3)XBxg;(}Bqb?sU53WPy$Z7!6ND?g9a`MDG_!TvG}Q2+kIyUg?M^|6 zx;(HM`w)owM8x*GEMwX!4AOZxF_`&!5MHw!O_b4~Osut2s2=D25Lx2r()Ogs^Az=6+x{(nr(uAdm$*zzsnOQV**Uu=Az=6$9sZ4%V#dD^yWNPSNN1b>peQtPOnt&&J@yhd-xMa7lXKzO! zS2@CXAc|0iZSSyA)0o62c*{=8os>iCy$+ukeF)acm|p9C4YFzMk;sOWM-$S5qv?er z)9IGC>9zRB1vK~7{&O}{eIs66-etk`LKWBQ|JIlta4mZnxv0*Z30g<%x#1ym`A?uN znx+|qViDCeDR7Cl>{H2|JSpA7iqe zN4^X0PG>Qljo_qS+7{vJynsB8OW9%lA-yW;!eYuNb47HS^=ra$D`NqP)h))6VoN|# zNLv+%GcI>q1j|FlLakqsSnMEf7)uy*4wozvjWPyq`?1bA`moAY zb8l?IkETnzFx^HUx>3SKO(-NhhQNcuO)iNqv`CYUhJ-Zw~XsA7hQC*>qITre0lj*Ko18RN(xKm#_vR~kM+3z?kq2ii+q@UlG|sFC1;SIDcNd0v+m zN&1M5V)Bhqo>??ji<2u@2e&{=t&8D3w>qDxB-#F=l=Kt>hr@{c_NE$6wl=QzO(i1n zxBZ_v6TQYVITZ+|YkvL_YjUD-wsN*DXaU!9k(Pu3eZCmMrMu9JU|>2Fe^#Cp26TB| z@DLpHr8JM%WsOWY2MVYgioZ~=HhZe>ft{#xZ7^m%E=CRPw2rL!3%_(1YZ4{r71AVzpVSFrv)mu&^X@!t=G!;(B*=MJg z;e)|w94FoeLohL#bXJABI^chR6Br{h`bcS-{gv#}3eK^6nn>XjtFlsyvWsm~B)?w5 z&n4vLX4?JDYxDW!e5Lm;RLZzV(-&x}TI}!^ zeXAJD7*t-}*TEUQ9pq;FhXzjMLVE+s$&)zrIo30s6P5o6ZJ=yZV*A`{wYvDw2Zfz~ zyBsv*>nm`F#P*Q5sXD5T;tdorqM=$Y^xh0uZs+kjl}EX6`w^#RF*oRT7A;B{SAu8-A86vHw8S1`!!R!v)v5BN->UceTSgaFDIG?L0#2Q ztS&8p8vzvIxzPj({KzkQ40z)US6W@LcKlb)?B_Nn~#pu5*6Vf(p(gFWDE= zhi})B9>$UsBnli$wNXDTmZ>mFhl75GJq%Wt3^TcxX&Q6tnioX7Nye0ZrBYiAs`Qk-DpeyU!2(itB!LZqAO_=K2(1PthfPn3QX{b%r?@wa2 BkE;Lx diff --git a/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json b/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json index 9e05785d..72bfbc1c 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json +++ b/data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json @@ -282,7 +282,7 @@ "VariantType": "Repeat" }, { - "LocusId": "ALS1_NIPA1", + "LocusId": "ALS_NIPA1", "LocusStructure": "(CGG)*", "ReferenceRegion": "chr15:23086363-23086389", "VariantType": "Repeat" diff --git a/data/catalogs/STRchive-disease-loci.hg19.general.bed b/data/catalogs/STRchive-disease-loci.hg19.general.bed index 0b8d83c7..4e5a96ac 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.general.bed @@ -46,7 +46,7 @@ chr13 100637702 100637748 HPE5_ZIC2 ZIC2 GCN GCN 25 AD Holoprosencephaly-5 chr13 102813924 102814076 SCA27B_FGF14 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B chr14 23790681 23790712 OPMD_PABPN1 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy chr14 92537354 92537396 SCA3_ATXN3 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease -chr15 23086363 23086389 ALS1_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis +chr15 23086363 23086389 ALS_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis chr15 34711626 34711652 aFTLD-U_GOLGA8A GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U) chr15 89112664 89112683 CHNG3_MIR7-2 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3 chr15 89876819 89876860 CPEO_POLG POLG CTG CTG None Progressive external ophthalmoplegia, Parkinson's disease diff --git a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed index eae92a3a..f0a9da57 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed @@ -45,7 +45,7 @@ chr13 100637703 100637748 GCN HPE5_ZIC2 chr13 102813925 102814076 AAG,AGG,CAG,GAA SCA27B_FGF14 chr14 23790682 23790712 GCN OPMD_PABPN1 chr14 92537355 92537396 CTG SCA3_ATXN3 -chr15 23086364 23086389 CGG ALS1_NIPA1 +chr15 23086364 23086389 CGG ALS_NIPA1 chr15 34711627 34711652 CT,CCTT,CCCTCT,TTTC aFTLD-U_GOLGA8A chr15 89112665 89112683 GTTT,TTTG CHNG3_MIR7-2 chr15 89876820 89876860 CTG CPEO_POLG diff --git a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed index da5a0486..e2e9457b 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed @@ -50,7 +50,7 @@ chr13 100637702 100637748 GCN HPE5_ZIC2 HPE5_ZIC2 chr13 102813924 102814076 AAG SCA27B_FGF14 SCA27B_FGF14 chr14 23790681 23790712 GCN OPMD_PABPN1 OPMD_PABPN1 chr14 92537354 92537396 CTG SCA3_ATXN3 SCA3_ATXN3 -chr15 23086363 23086389 CGG ALS1_NIPA1 ALS1_NIPA1 +chr15 23086363 23086389 CGG ALS_NIPA1 ALS_NIPA1 chr15 34711626 34711652 CT aFTLD-U_GOLGA8A aFTLD-U_GOLGA8A chr15 89112664 89112683 GTTT CHNG3_MIR7-2 CHNG3_MIR7-2 chr15 89876810 89876816 GCT CPEO_POLG CPEO_POLG_GCT diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json index 14f5ecfa..b61d5431 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg19.stranger.json @@ -611,14 +611,14 @@ "Gene": "ATXN3" }, { - "LocusId": "ALS1_NIPA1", + "LocusId": "ALS_NIPA1", "ReferenceRegion": "chr15:23086363-23086389", "LocusStructure": "(CGG)*", "VariantType": "Repeat", "HGNCId": null, "InheritanceMode": ["AD"], "DisplayRU": "CGG", - "Disease": "ALS1", + "Disease": "ALS", "NormalMax": 10, "PathologicMin": 11, "Gene": "NIPA1" diff --git a/data/catalogs/STRchive-disease-loci.hg19.strkit.bed b/data/catalogs/STRchive-disease-loci.hg19.strkit.bed index 7e6382b0..221f5c0b 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.strkit.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.strkit.bed @@ -45,7 +45,7 @@ chr13 100637702 100637748 ID=HPE5_ZIC2;MOTIF=GCN chr13 102813924 102814076 ID=SCA27B_FGF14;MOTIF=AAG chr14 23790681 23790712 ID=OPMD_PABPN1;MOTIF=GCN chr14 92537354 92537396 ID=SCA3_ATXN3;MOTIF=CTG -chr15 23086363 23086389 ID=ALS1_NIPA1;MOTIF=CGG +chr15 23086363 23086389 ID=ALS_NIPA1;MOTIF=CGG chr15 34711626 34711652 ID=aFTLD-U_GOLGA8A;MOTIF=CT chr15 89112664 89112683 ID=CHNG3_MIR7-2;MOTIF=GTTT chr15 89876819 89876860 ID=CPEO_POLG;MOTIF=CTG diff --git a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bb b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bb index 726b2ccd5b33549b0f438ac8416994ca84ab002b..863e5cc9399259c7d6875a4e4cb62f5ef574d721 100644 GIT binary patch delta 594 zcmZpBz|{JHX@Uf!+eAtIAR}7_FtBlg&{r5CbVU?|z8eRj1K1(7WI2S6tcK7IvJiUe zWC(q9`s76QX`2lg_e$0m+`0RNvz;N%S%P(Ahl|O?3f@G4GcOM;Ry(^%aE|k)#wR6a z_hzj-IBDx8ZSCl1r@|s1UpUAXd%ZgJtlr6Yf7hq`Yd6(I=a_fJ3rraJf6{;l>QhiBPs)|Rp1V07D@p~B51 z*#V6gP&CA_@Gyet_4bymT9bR!iRza`Hy5bOFm0}kYGq-(JNbW{GFJ^W;uBeraR9&C+_V4y delta 579 zcmZpDz|{7DX@Uf!`$S3oAY)qwFtBxk&{r5CbY&ETz843f1K1(7R5^r>s)o=GvJiUO zWC(q1`s76QX`2lg_e$0u=-)lt=ApoWY>veWViP;mgw`waG+D}4Tv-xn)>Q0aHet@W zW6_sQBQ}LqrKX;axv7;cV|8P}>#FsuZmRy=`~T~kOxFqd-EY%AzMS!Pd!&$h%C3ft zosVK#l9a*~KN!sOZ`glokw%aQ_k-6A3Ll^Id2jli*8A<)>fm&?@7L~lovzmk)%MM_ zkvh9?aehR7_jlW>D^oTltvJ1{{L9N5r!_BVpIBRY;9=ml3HBE6x;ud{ZG-y$rGMk|DEi|>)>-h&q z!>`R|&cTLJQ}R=)jbc}4O(~w{UEO|5^6w$TQwx>^|KI+Neec>?`J1(5Y&aO*H>ay` zGf8$rBL)-?F)TccAbP#MC9C%2ZZ&zvFOydT$;*>Z1Igu+UjxbMleyL985<^R1Ib03 zz10P!nQWaV|Bq8*G~e9lR3pQ9Z}Pu5Wv*IiJSVbjPE@}ry177ImT9wOc>)VlR5e(& W+~#@J?lMfkcm?U5wV7+iZ*c%!Hso&r diff --git a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed index 6b95884d..b42d7db1 100755 --- a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed @@ -45,7 +45,7 @@ chr13 100637702 100637748 HPE5_ZIC2 0 + 100637702 100637748 0,128,0 ZIC2 GCN GCN chr13 102813924 102814076 SCA27B_FGF14 0 - 102813924 102814076 0,128,0 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B Definitive chr14 23790681 23790712 OPMD_PABPN1 0 + 23790681 23790712 0,128,0 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy Definitive chr14 92537354 92537396 SCA3_ATXN3 0 - 92537354 92537396 0,128,0 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease Definitive -chr15 23086363 23086389 ALS1_NIPA1 0 + 23086363 23086389 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed +chr15 23086363 23086389 ALS_NIPA1 0 + 23086363 23086389 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed chr15 34711626 34711652 aFTLD-U_GOLGA8A 0 - 34711626 34711652 128,128,128 GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U) Provisional chr15 89112664 89112683 CHNG3_MIR7-2 0 - 89112664 89112683 64,160,0 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3 Strong chr15 89876819 89876860 CPEO_POLG 0 - 89876819 89876860 200,0,0 POLG CTG CTG . Progressive external ophthalmoplegia, Parkinson's disease Disputed diff --git a/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed b/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed index 05428a61..447acaac 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.TRGT.bed @@ -45,7 +45,7 @@ chr13 99985448 99985494 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC= chr13 102161574 102161726 ID=SCA27B_FGF14;MOTIFS=AAG,GAA,AGG,CAG;STRUC= chr14 23321472 23321503 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC= chr14 92071010 92071052 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC= -chr15 22786677 22786703 ID=ALS1_NIPA1;MOTIFS=CGG;STRUC= +chr15 22786677 22786703 ID=ALS_NIPA1;MOTIFS=CGG;STRUC= chr15 34419425 34419451 ID=aFTLD-U_GOLGA8A;MOTIFS=CT,TTTC,CCTT,CCCTCT;STRUC= chr15 88569433 88569452 ID=CHNG3_MIR7-2;MOTIFS=GTTT,TTTG;STRUC= chr15 89333579 89333629 ID=CPEO_POLG;MOTIFS=GCT,GTT,CTG;STRUC= diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed index bace0b9f..308b1d06 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed @@ -53,7 +53,7 @@ chr13 99985448 99985494 GCN 3 HPE5_ZIC2 chr13 102161574 102161726 AAG 3 SCA27B_FGF14 chr14 23321472 23321503 GCN 3 OPMD_PABPN1 chr14 92071010 92071052 CTG 3 SCA3_ATXN3 -chr15 22786677 22786703 CGG 3 ALS1_NIPA1 +chr15 22786677 22786703 CGG 3 ALS_NIPA1 chr15 34419425 34419451 CT 2 aFTLD-U_GOLGA8A chr15 88569433 88569452 GTTT 4 CHNG3_MIR7-2 chr15 89333579 89333585 GCT 3 CPEO_POLG_flank diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz index 186542660fa2c1b6330ecc8ddf3fa4f39024be6a..4ed2ac66dcb7e54cb22e250261c0af9a20af76da 100755 GIT binary patch delta 1408 zcmV-`1%LY74&4qBABzYC000000RIL6LPG)oK(P_l0e^d5u4`Xr7PK+w4IN++VgiES z#&jFLeB|kVn}Q2ncFwXlT6eGnQ%VU8#LF`2JYP5YLWk?ME(^YcvoOU38sd7s=kx_Q)omf z-vD*#(OBYI33f52$_Yrp7S}zWucHaA7zfPkJbwbSuqK#FS0rGF>&Kka_j&J{wbn6O z-GEB1Yfp^lIOv?>*j9rFV^Il7Ni|y!C4`0;O4ZXem7p7@RFd*{3NcKfhTRlnDrJ}Y zPAP?H3e`+0^blNLs4+Q}KWatmO9{M(dHYzyx4ho2%TbdOXvA69!MoRL;~Ya=0)|61 z#(%Ri*r7zy=PpEfx~@Isdq5|Sl{Ot}$SafgJk0oI-9xoZII@oQm9Pbi7PoecFb`L6ml3x-A!TTwJPnegwMdV zuLI`G{W0L7dgYvQa*(HEqEEvbraayDDt{^QXZjh`$bb-In#Qd3dR*@w(-aewKlGW>8;6Fj|C- zp$_6pjr*yfoN@@x>x?<>=~Uk+oh4=2bZ|;~|EBwx)9Ha-(@vw51z$lwC)atMbAQ~I zuXygFvEr?^rhy>?W!dyo6RNsHVBID)u=YsoOanpticC^PdGpHS2BqKPXYbX28jw5+ zS>aA>>x`YiKv@WJIj!$vdECiYF}#U?&9_L6L>q_!=;yL_-mt1GxDpdAQ;Gbi^}Oft z{0s9Q)3%eS!SZEOLt z*D&zQso)g$_4kx}*`h3?SDi?qycP>ePHj>Pkf8T0u7Nzq>M~9xTn5x%uGj0E>&SLs z{F(cvdNLiDf1)m4 zJ=-^Okjize&lSvjn1^P2C?UJd=?2y?#CjV7hA|D{wquU|KY#uq-Dj_~kf;uhAppX- z4Iz(@>{n0=Q$EMLA|uh+b8!+(6#7qwP`DAGxE z+mz~Oswbd&(wN$vFV(hag84ptcR8NxP3i$2w&Xjo z?W4JFY0qJMyjg6z#a_B~zMjwc(lnAY)=GoY>XhmccOLRE4{uU=)&Mmmz(aZU@B>)t zYUKt7k2BhSnnMm-lVJpn)ykR%s1d?cgBQbNSaS*^_Ab$4nH}*#mizkp7GgSYw@0}# z=`I^(l__O+dM=2^?KE=*Y?J)4=W*VS(v7o9u`->+z7NT{oO9@x O{{nTeMAMp+JqI6)WW;X( delta 1407 zcmV-_1%Ue94%`kAABzYC000000RIL6LPG)oKd}+k0e?H@<+}EDWw<);LW#=q=qjd*MFr}2hK)fuI&hvGXFLbzG>$2iII15uupdqg3dtUFi z>1_z?OX}cC&i~JL4Ve7@=3PAo6eG$j=|BWijAeeG{x(p4e7_~^CK*O;oNHh;K}snG zurP-C%zrs8TjbDXX5*Fi9SoPDO?AkIVDgXg^3Yv$!pe}N2KqT)FT;)Uuj{3GrPWTkGFcn2`qU_ww{XR-I)z4* z@(oaz9*rfim1q}Zs+@onY;oQ5`8t}=igCcq&VM5?3u}U@bVUM&xPHtzeV_NPS!*4m z)eWfBy7t6)j)TrAj%_)3Fcy`NlvK0zP-19^p;SFhQ;E7^N+l_Orx3#wYTQjRrc!pP z@03!Qrclk4LXW}ag&LGo`J+~}zLdawn75BLe9Pp5qL%~iunK!Ww)IANK@WZ*am4XDuv3_t+?brU|&N9nQ;rwfwGHX=&-v zpQx|6Kne_ducfD6piJEG+?LaGr!F-kf%xl?*KJw1P?3X9o3E1fxaR z80sLt)VLoD$}xxFyv~^8o=)|R(pgfLO$Vo>_iwt7Ih`KZHSIJ?S@0F~b8?;6Ie*7} z`HJT*8Y|vvYZ@3bP?k+UHleCp1lE0018a}O&NL9TugD}-lsB(DZczFye)eAdrvb^M zkQMI4w$9iI43vcsm(%(#mdBlZ6~mkO*L;iANVI_%fPOA(=MAg6f-5n>GL^`GTF-kP z?~faG(`iAXG8CQoQ;;Ptt|4!aEblG4lYTDO#a@2Y0JYG^=v zZCsfl4V*5ggSv&puzU-9-o_R%3>Xw+y-)>K`e;gwmp!kS`=cGb450Pe)N|26?o(SN zZ(*IzV{MEDRNAspx&z`TS?4)y@iKCk4LfmV@H^SJLlRP6*Oj(b5eq0{%YPxscd{Da zqG2Axj9yol0ktM)qysDcZl+Vj7Pc6WH3@6oK+5WSmfz-e^Nck_?6846H{2M9ynQSW zdJO}=oC;21Uw==zmo3UNdew;(%4@Np|JL=GZ`+F0Rdkx! z*Ta1y2dUi0`dq=hhk0nWhZ3^OoNizZL#)>!U>MU-51`Ti=g&W+`|On#64k*m1V9+K zA>{F~yhh8vgbG@jaw)8hYi_epD|X1`=GMp@v+uHp<;%D0^_tghn17G@qSi_fMLLOY zn^OHu^#oK;8dJOUrP>xvFyDvoF2{4dNN?0y}ZIVCsJkHxux^Y%1R;H8K_aQl#a}NFT NUjRzc>6?>22Op62z?lF5 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi index 1affe3b9f78ad76b7f7b8348bbed8516c3aa92c0..dcb0f4843e43efdfb52adaf356c807b7ef06ce55 100755 GIT binary patch delta 2100 zcmY*adpy(q9^aTvmt`)gTyk4F6jHgYY0NXU97>E_n&ee!c<3@uDqDy;C(r8aS9o}E zJSzOelFQtAPMsuC(%KOtH9TRhHfv{Qc7Ahoa$c|BKi}K?`+mPa@89P;Z9QfEpbo(# zz(phYK(ioB_5kNpm+5DJ)^@``ze{v?W^>1LU>K`HuY#N$pPNAKI!VvdRV|UvE%h@W zR|+c_6rSMs>iJ#9WHxsBW03Sf8JJDm70Mf8P|TxwRJz34GlA>Ke0{LG8*DMHnpT6^ z)eLA|#5HOBRMQR4TgfMIHs2wZuoNxv-!Qq0=YZ3ChCs5G;c$mf8C5OWn++A>!1 zuzN_#31+y;`E?tl3p?e~qms$EXL*a_*=gl1CuJ|bJFJ0ASD!0}2rxMJR1>2+<)0O) zdEdxtZfKP7*MnZRGe0ChBcPr^7d9jq@i;ynZ_rxAu{l@s2EN zqLt}k62~Af(27{hNo9+F4W<_u12I}A`-FJvQ>Qbyn^>|0sQIqvOa(}8z`bsIi>A;w zgR~K8Vwelaa%xw#`RXYnJMsn0m3$T)ZU6&otRb~Jy26rF9XEX}Swn~!3Kt2S_y0h| zAm2F`kPxOm_*%pD30E#>S!Ucm`PBUJu7AbFi|k%ShF^deMs@i=K6WxE2tmB&-H}N6 zT9Vp|I={nI|I5ptEg@oxU3oU|FW4Njv!?DWyz^7514qT+q^4R7C|*XVZau+Q%-3J- zJnQ|f083JU4)`YKhJGr^Ok6L&gH+|B2g^md^0U#h3n#(RJaExNl7@C0mh;^9TW})? z{b@za+o>{&ik^4@NoEU~r%C^+BNK0%HEO*v#|pPX&cIM-ELA)Y~I-RsdBz=U=H|#GDM~R8|nV#iJrzLz(RK| zGW?a-q;o0Yteb#nyLCK%$v!HSajQUWq7m{Pv-IU5a`0MAhOhp?^=6l2>oabeIHqsK zMj^8N<+YjARt16%e=*k77jf=Xr{$_JJ}g+e2=+f^IXlV<|UF-i(~*0#Tl}k>nH< znY|s7JNGcEL`mj-EL_LNHgDQOnQGgz5sKHLhIVZ8$3SvTdnB34VuMl(6VaBB3*1nt zeJ|ZD;o?4^7H-b$q1W?=_~BpA5qAH0vU&2VY~2g;SnQcLq79d)e28kA6+5U@+xehCTay4kp^0Gi#|8}?FanbtLSU1{>Wfq3<6#v)2zH35nfYU{0KMj0@$d z4nCS4tErl9yO^|W^um#?5D!~a=bVlK!5~9pj_U+W)K`1TJI2UsT&h(m;nvn20CZlp z5w158kv%3X%O7Kp&uHZmNZS!>##{SP@~9??@`g1~y4D?m?YX!a>Kp6*drUjRI@Pk! zYF~=^le-R6bHTw4tu2w9c+j;hVopp6;CX;PYUTY?Uy?Rc8dNQ_|Es(re-~MDcjP9v zr~Ew9xnC5#^a~tBqqPr^jsZu}2?+hIBQBcBI0Z~3s11OKW{+=pApB}TQQx zwKCn|e`x^XM7BmbM7UdWCE0Qu*9WM36@Kmta52|sMaq&M`N+N;k<#k!gR+AZy@08y z<`XW>C`F`1Zbuw-21Br zP6FQxU;Wq5_cZj}ZQ!E*c89FfMqT4$(Kfo`M8xeY`Xq-vLH3`tOzsjx?6o&`A!zp= zWUjhJZ9p^^4|?EmB@{P2ps!~EMOT-pF4w~<{6_8<2gZkRuY;ge23CDA;mw3l#KDv! z7QBkh<+RYTy_L>0_^1$GFZt(iMr{SytBj}`P3agFOvjHDy~*zrID)i`oF@s4SP-1b zG~t~APcVx`{Ct^1IoN_*93ieK9hn^!;ARU=EZ*~HBO!;jiESXIn+z9EM?>xTh9VGp m7SNtBBE6fs6rvdn8nvgQ=ot~e8c<{W5G0GVYiCR4lpQ29X((oV=4uHA%M2klP|_nD{=cvck-X5c0K! zcWjxYQHIubapd-)_sC_MFq+U%GdsBqGv7PfTIamyJ@4)R{GQ+QJiqrZFrGDTY(mj+ zNa1)}pkAa_=LGNmMct33H%3r9TF`zLkI-iiQucbaWy?% zbiq8`j@H{V))670?4_F${ywOMRUxI!-5@si(y%#k(D%N&FEDi#gzzE z1L%yk^9^8ywfzS!_bOl_kq#X__z%Q7mMEJ26?1-V#*@K9nnm*|EmO>;8W(Bsfs{12 zXw9aI{-f<>Qs#(UylT6+c1E-k`?564y>-Q9x?3jdTlw$R&-3yML6B=hH8Y0xh~2}b zQAf?bGKJy!HOCZ1x*R941iITtZTAY}IL3goj`biy*jNl+Fu>8HP79STqqaK@t2#WmlW9Til9IagHz2yr} z99!?bPKq=)o@5z#!2*lU-t~LNO??*b!})RhzhC@ybGq4}_L!!2o2KO2;_1W_u_^Ye zl@c_5gBJ`Aa(6I)*6GqE#+pMA**110aD_803Z9?iygLL@>%n`)_~yH5qhi1@pgJ|e zqd&7v?jQ!4Vs`I57M4N&eAjw|d;@2T(sOIwaJ#F0>WoNr4Bq;)$>dMtD?+0DO-%S& z<{pEq<+`kvlYLEv3$>5Cn?6icq*of~H*@Ce#nP#Hs|}>SNY)j-wAECgRG^TFp{KS* zrEJji9qT5;N-Y+pn=%5f%XbRSw$Wi_FCCS)v=~Bw*^w<;IR~{90-X@U=P=%$3F=!B zIr*oY5G8vI$#}Ii1j}_K4uet|$m*w-(cb8~&zg0K4UIN<#GH2hcGuO+F6E1CM)0;f z%?Y*!=7hoi)0yWjfZBMMLv%jbqTa<^u>1poehU=v6|h@ZMt@9U*4K2Yua-IP%oN&-Bd-+z1+CTe9tCg>u+(gzz~_8==@C*9E_>I*i1HMe`304i zf!!b;PB)gZtg+cTH3XVCPJ-e9p!U;;y$e$I9pCf%K(q8-3@c3!Xy(0ouoQF)oSze@ z5JXKkR2h*Me;NCi3kLr{ zrBPdX=d{^7)_(?vKz#cc^^t{h?X2x~80iOx<@mc`=bc|>U5Jn!5&A^T4{JYh47%U% zDx_SOR7C+?P5U01@G;oex@i8z>@Hr4F}&1FRTMx9wG0bTRCaiW5caZSyd!lyC&Wti zA~wNNY8Pe*G524_oGEIU(3o@}mROydIq=N8Q43~}(4QO8oUw;dv&EK?proeEna(aA z*cQNzgwNVu!KtpzAT@QaWTKR~NF(Vuui|V`$L5hdSB?b?@J=j$_qXo%I#l&HA zbM}4zR>jI*-PEl%T|{%1t67jB-u(?(;>Werd9+hb#+3lg`rvHM%&OaPLpXY}%VXo2c{01dn9$=+6vYFNILJSkD77n%DXeKV#~i>!dbb9AuUl!b&D3 zc`)y?ufT1Z(_}#l1W{>Aoqi!D#IYL$ha_PB)7?;a2oQf1IHCWlPX7*>$nyYg=Eg`w zNE}=cmi4d!6t{*mPqICD-1o`j`oq_IxqF%9aL|QYk$vL>L5{ z^}+BDwqZBeDl}n2E z3?~vg45;HQ@xY`>vuuRxLb8VBcve=ct`QY!OUrfH5>vHYD+9Ub0;da`=*t& z%JO5U2KQFo0hg158zO%p*XksO$Fdz0e>r6rEh4?%W^DiI<}O^(F>Vz3LF_R$6Q4rh zE!|)!X;xv>3^Kfd4K;0*td+o`dP6GYTndX>n{%gZbJj{6ggLGl>`)@>(Y(0YUHnF* z`G?zmjtxxCF=Nb+qKO1Fe%{U~Ns9^ZVHl>?+!%4l07ljZpc*M)Qq>G7i4*<{H-l3l5nPmQSbJ1m%WJ`w dq+t5HkVeVZhF}KH4FA8iM~cLn_p?PDe3Y-dqul@i diff --git a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed index c9574eed..a24fe96f 100755 --- a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed @@ -45,7 +45,7 @@ chr13 99985448 99985494 HPE5_ZIC2 0 + 99985448 99985494 0,128,0 ZIC2 GCN GCN 25 chr13 102161574 102161726 SCA27B_FGF14 0 - 102161574 102161726 0,128,0 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B Definitive chr14 23321472 23321503 OPMD_PABPN1 0 + 23321472 23321503 0,128,0 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy Definitive chr14 92071010 92071052 SCA3_ATXN3 0 - 92071010 92071052 0,128,0 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease Definitive -chr15 22786677 22786703 ALS1_NIPA1 0 + 22786677 22786703 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed +chr15 22786677 22786703 ALS_NIPA1 0 + 22786677 22786703 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed chr15 34419425 34419451 aFTLD-U_GOLGA8A 0 - 34419425 34419451 128,128,128 GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U) Provisional chr15 88569433 88569452 CHNG3_MIR7-2 0 - 88569433 88569452 64,160,0 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3 Strong chr15 89333588 89333629 CPEO_POLG 0 - 89333588 89333629 200,0,0 POLG CTG CTG . Progressive external ophthalmoplegia, Parkinson's disease Disputed diff --git a/data/criTRia-curations.tsv b/data/criTRia-curations.tsv index f47b7ee1..7e2fb5cd 100644 --- a/data/criTRia-curations.tsv +++ b/data/criTRia-curations.tsv @@ -33,7 +33,7 @@ LRP12 OPDM1 AD 8/18/2025 Strong 12 12 0 2 1.92 Autosomal dominant oculopharyngod MARCHF6 FAME3 AD 08/12/2025 Definitive 11.5 10.0 1.5 3 17.33 Autosomal dominant familial adult myoclonic epilepsy type 3 (FAME3) is associated with an intronic TTTTA/TTTCA repeat expansion in MARCH6/MARCHF6 on chromosome 5p15.2. The expansion was identified by genome sequencing and repeat-primed PCR in four European families with cortical/myoclonic tremor and epilepsy, co-segregated with disease, and was absent from controls in the reported analyses. Expansion length, particularly the TTTCA component, inversely correlated with age at seizure onset. Patient-derived blood cells and fibroblasts showed marked somatic instability and expansion-size variability. MIR7-2 CHNG3 AD 08/18/2025 Strong 13.5 12 1.5 2 Noncoding TTTG STR changes at 15q26.1 between DET1 and MIR7-2/MIR1179 are associated with autosomal dominant CHNG3/resistance to TSH, presenting as congenital nongoitrous hypothyroidism and/or multinodular goiter. Two 2024 studies reported recurrent (TTTG)3 deletions and STR SNVs segregating in families and enriched in congenital hypothyroidism/MNG cohorts, with locus-specific functional evidence that the STR has thyroid-specific regulatory activity and that pathogenic STR variants disrupt or activate regulatory programs affecting MIR7-2/MIR1179 expression in thyroid tissue. NAXE NME AR 08/12/2025 Limited 5.0 2.0 3.0 1 A biallelic GGGCC repeat expansion of approximately 200 repeat units in the NAXE promoter was identified in one proband with autosomal recessive NAXE-related mitochondrial encephalopathy. The proband's homozygous expansion resulted from maternal chromosome 1 uniparental disomy, with the mother carrying the expansion heterozygously. The expansion was detected by long-read sequencing and supported by RP-PCR/Southern blot family testing, marked reduction of NAXE RNA and protein, reduced nascent promoter transcripts by NET-CAGE, and CpG hypermethylation at and downstream of the repeat. Screening of additional undiagnosed mitochondrial encephalopathy cases did not identify another pathogenic expansion, and available cohort/population data indicate that expanded alleles are very rare. To date, this locus-disease relationship is supported by one publication. -NIPA1 ALS1 AD 06/06/2025 Disputed 3.0 2.0 1.0 3 2.33 The NIPA1 exon 1 GCG/polyalanine repeat has been reported as an ALS risk or modifier locus, with some European cohorts showing enrichment or survival effects for long alleles (≥9 or >8 GCG repeats), whereas African-ancestry and broader Project MinE STR studies did not confirm an ALS susceptibility or age-at-onset association. The evidence is conflicting and largely association-based, with limited direct locus-specific evidence, supporting the disputed classification. The evidence does not currently support a Mendelian association between the NIPA1 repeat and ALS. +NIPA1 ALS AD 06/06/2025 Disputed 3.0 2.0 1.0 3 2.33 The NIPA1 exon 1 GCG/polyalanine repeat has been reported as an ALS risk or modifier locus, with some European cohorts showing enrichment or survival effects for long alleles (≥9 or >8 GCG repeats), whereas African-ancestry and broader Project MinE STR studies did not confirm an ALS susceptibility or age-at-onset association. The evidence is conflicting and largely association-based, with limited direct locus-specific evidence, supporting the disputed classification. The evidence does not currently support a Mendelian association between the NIPA1 repeat and ALS. NOP56 SCA36 AD 08/11/2025 Definitive 13.0 12 1.0 4 13.75 Autosomal dominant spinocerebellar ataxia 36 (SCA36) is caused by a heterozygous intronic GGCCTG hexanucleotide repeat expansion in NOP56. The relationship is supported by multiple SCA36 cohorts and families with repeat-positive affected individuals, autosomal dominant segregation/linkage evidence, and cohort screening showing NOP56 expansions among undiagnosed hereditary ataxia cases. Experimental support is mainly gene-level: NOP56 functions in box C/D snoRNP biogenesis and ribosomal RNA methylation, while several cited functional evidence rows require curator review because the provided sources do not directly test the SCA36 repeat locus. NOTCH2NLC NIID AD 08/14/2025 Definitive 14.0 12 2.0 8 5.08 Autosomal dominant NIID is caused by heterozygous GGC/CGG repeat expansions in the 5′ UTR of NOTCH2NLC (also reported as NBPF19/NOTCH2NLC). The association is supported by independent long-read sequencing and repeat-primed/GC-rich PCR studies in familial and sporadic NIID, segregation in affected families, expansion enrichment in disease cohorts compared with controls, and replicated clinical/pathologic findings including multisystem neurodegeneration, characteristic DWI corticomedullary-junction hyperintensity/white matter disease, and eosinophilic p62/ubiquitin-positive intranuclear inclusions. Reported functional observations include altered methylation/regulatory findings and patient tissue pathology. NUTM2B-AS1 OPML1 AD 08/18/2025 Moderate 9.5 7.5 2.0 4 5.0 A heterozygous CGG/CCG repeat expansion in overlapping noncoding exons of bidirectionally transcribed LOC642361/NUTM2B-AS1 is associated with autosomal dominant OPML1/LOC642361-NUTM2B-AS1-related oculopharyngeal myopathy spectrum. The original report identified the expansion in one Japanese OPML family with leukoencephalopathy, with segregation in affected relatives and absence in unaffected relatives and 1,000 controls. Subsequent independent reports identified OPDM-predominant cases from Chinese and Thai families, expanding the phenotype and showing variable or absent leukoencephalopathy. Patient-muscle studies showed rimmed vacuoles, p62-positive intranuclear inclusions, aggrephagy/RNA-binding protein accumulation, and mitochondrial abnormalities, supporting a repeat-mediated pathogenic mechanism. diff --git a/data/plots/age-onset.json b/data/plots/age-onset.json index 16c3b21f..fe629930 100644 --- a/data/plots/age-onset.json +++ b/data/plots/age-onset.json @@ -13,7 +13,7 @@ "orientation": "h", "width": 0.2, "x": [2.0, 47.0, 32.0, 39.0, 52.0, 51.0, 44.0, 66.0, 71.0, 59.0, 0, 41.0, 19.0, 46.0, 54.0, 57.0, 28.0, 25.0, 0, 53.0, 54.0, 6.0, 72.0, 40.0, 23.0, 40.0, 20.0, 75.0, 54.0, 60.0, 0, 61.0, 59.0, 71.0, 57.0, 0, 0, 47.0, 56.0, 72.0, 10.0, 70.0, 84.0, 68.0, 0, 0, 0, 1.0, 84.0, 6.0, 0, 0, 73.0, 76.0, 72.0, 74.0, 10.0, 0, 92.0, 0, 0, 3.0, 36.0, 0, 0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -29,7 +29,7 @@ "orientation": "h", "width": 0.2, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 57.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.0, 0, 0, 0, 0, 0, 0, 0, 0, 78.0, 0, 2.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 10.0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -45,7 +45,7 @@ "orientation": "h", "width": 0.2, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 78.0, 0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -61,7 +61,7 @@ "orientation": "h", "width": 0.2, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 67.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 75.0, 0, 0, 0, 0, 0, 1.0, 0, 0, 0, 0, 0, 0, 0, 0, 3.1, 0, 0, 0, 0, 9.0, 0, 0, 0, 0, 0, 0, 9.0, 0, 4.0, 4.0, 0, 0, 0, 0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -78,7 +78,7 @@ "showlegend": false, "width": 0.6, "x": [0, 19.0, 10.0, 20.0, 16.0, 0, 0, 28.0, 14.0, 19.0, 0, 0, 0, 20.0, 0, 9.0, 0, 0, 0, 19.0, 22.0, 0, 36.0, 0, 0, 6.0, 12.0, 6.0, 24.0, 18.0, 0, 0, 20.0, 40.0, 19.0, 0, 0, 0, 18.0, 29.0, 0, 39.0, 9.0, 14.0, 0, 0, 0, 0, 9.0, 0, 0, 0, 28.0, 29.0, 20.0, 20.0, 0, 0, 44.0, 0, 0, 0, 2.0, 0, 0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -95,7 +95,7 @@ "showlegend": false, "width": 0.6, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 16.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 9.0, 0, 0, 0, 0, 0, 0, 0, 0, 5.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2.0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -112,7 +112,7 @@ "showlegend": false, "width": 0.6, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 64.0, 0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -129,7 +129,7 @@ "showlegend": false, "width": 0.6, "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 29.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 8.0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0], - "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { @@ -711,7 +711,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], + "tickvals": ["OPDM", "FECD3", "CJD", "SCA36", "ALS", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "SCA", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "NIID", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "FRAXG", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "title": { "text": "Disease" diff --git a/data/plots/path-size.json b/data/plots/path-size.json index 22cd84c4..885c708d 100644 --- a/data/plots/path-size.json +++ b/data/plots/path-size.json @@ -13,7 +13,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 110, 66, 198, 0, 143, 99, 54, 54, 0, 51, 780, 25, 513, 51, 51, 105, 117, 149, 0, 0, 39, 0, 12, 30, 123, 222, 60, 0, 220, 96, 179, 95, 59, 105, 60, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 42, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -29,7 +29,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 4085, 3804, 0, 0, 246, 0, 945, 0, 0, 129, 0, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 0, 60, 0, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 15, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -45,7 +45,7 @@ "orientation": "h", "width": 0.6, "x": [0, 0, 18500, 11100, 1287, 1925, 705, 2460, 11750, 2268, 1420, 0, 294, 0, 1851, 0, 99, 5397, 5397, 12, 3250, 17875, 1617, 820, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 195, 273, 114, 3687, 18, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 0, 0], - "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "y": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "type": "bar" }, { @@ -1306,7 +1306,7 @@ "mode": "lines", "showlegend": false, "x": [30, 33], - "y": ["ALS1", "ALS1"], + "y": ["ALS", "ALS"], "type": "scatter" }, { @@ -1944,7 +1944,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], + "tickvals": ["FAME6", "FAME4", "SCA10", "SCA36", "MRUPAV", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FRAXG", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "SCA", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SPD1", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN-VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS", "EDM1, PSACH", "CHNG3", "CPEO", "HMNR7"], "title": { "text": "Disease" diff --git a/data/ref-alleles/ref-alleles.T2T-chm13.txt b/data/ref-alleles/ref-alleles.T2T-chm13.txt index e7999ae8..c6705ba9 100644 --- a/data/ref-alleles/ref-alleles.T2T-chm13.txt +++ b/data/ref-alleles/ref-alleles.T2T-chm13.txt @@ -280,7 +280,7 @@ chr14 86300519 86300603 CTG TRGT ATAGGTCCCC CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG TTG CTG CTTTTG CTG CTG TCTGAAACAT ATAGGTCCCC CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG TTG CTG CTTTTG CTG CTG TCTGAAACAT -ALS1_NIPA1 +ALS_NIPA1 chr15 20458510 20458536 CGG STRchive chr15 20458510 20458536 CGG TRGT AGCTGCGGCA G CGG CGG CGG CGG CGG CGG CGG CGG C CGGGGAGGGG diff --git a/data/ref-alleles/ref-alleles.hg19.txt b/data/ref-alleles/ref-alleles.hg19.txt index 05f49ddd..c4141406 100644 --- a/data/ref-alleles/ref-alleles.hg19.txt +++ b/data/ref-alleles/ref-alleles.hg19.txt @@ -280,7 +280,7 @@ chr14 92537354 92537396 CTG TRGT ATAGGTCCCC CTG CTG CTG CTG CTG CTG CTG CTG TTG CTG CTTTTG CTG CTG TCTGAAACAT ATAGGTCCCC CTG CTG CTG CTG CTG CTG CTG CTG TTG CTG CTTTTG CTG CTG TCTGAAACAT -ALS1_NIPA1 +ALS_NIPA1 chr15 23086363 23086389 CGG STRchive chr15 23086363 23086389 CGG TRGT CCCCCTCCCC GGCCGCCGCCGCCGCCGCCGCCGCCG CTGCCGCAGC diff --git a/data/ref-alleles/ref-alleles.hg38.txt b/data/ref-alleles/ref-alleles.hg38.txt index ae54a50c..7c94da6a 100644 --- a/data/ref-alleles/ref-alleles.hg38.txt +++ b/data/ref-alleles/ref-alleles.hg38.txt @@ -280,7 +280,7 @@ chr14 92071010 92071052 CTG TRGT ATAGGTCCCC CTG CTG CTG CTG CTG CTG CTG CTG TTG CTG CTTTTG CTG CTG TCTGAAACAT ATAGGTCCCC CTG CTG CTG CTG CTG CTG CTG CTG TTG CTG CTTTTG CTG CTG TCTGAAACAT -ALS1_NIPA1 +ALS_NIPA1 chr15 22786677 22786703 CGG STRchive chr15 22786677 22786703 CGG TRGT AGCTGCGGCA G CGG CGG CGG CGG CGG CGG CGG CGG C CGGGGAGGGG From 7acf15f766615ff99c2d57e98c37098df56209c9 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Wed, 7 Oct 2026 12:46:13 -0600 Subject: [PATCH 17/18] increment version --- CITATION.cff | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/CITATION.cff b/CITATION.cff index bc261168..5ada5155 100644 --- a/CITATION.cff +++ b/CITATION.cff @@ -1,6 +1,6 @@ title: STRchive -version: 2.27.0 -date-released: "2026-09-30" +version: 2.28.0 +date-released: "2026-10-07" url: https://github.com/dashnowlab/STRchive authors: - family-names: Dashnow From daf3bdef4384b9d86b7df8ff80cad040560c2482 Mon Sep 17 00:00:00 2001 From: hdashnow <3794821+hdashnow@users.noreply.github.com> Date: Wed, 7 Oct 2026 23:05:26 +0000 Subject: [PATCH 18/18] Update data --- ...hive-disease-loci.T2T-chm13.expansionhunter.json | 0 .../STRchive-disease-loci.T2T-chm13.strkit.bed | 0 .../STRchive-disease-loci.T2T-chm13.ucsc.bed | 0 data/catalogs/STRchive-disease-loci.hg19.atarva.bed | 0 data/catalogs/STRchive-disease-loci.hg19.longTR.bed | 0 .../catalogs/STRchive-disease-loci.hg19.straglr.bed | 0 .../STRchive-disease-loci.hg19.stranger.json | 0 data/catalogs/STRchive-disease-loci.hg19.strkit.bed | 0 data/catalogs/STRchive-disease-loci.hg19.ucsc.bed | 0 data/catalogs/STRchive-disease-loci.hg38.atarva.bed | 0 .../STRchive-disease-loci.hg38.atarva.bed.gz | Bin .../STRchive-disease-loci.hg38.atarva.bed.gz.tbi | Bin .../STRchive-disease-loci.hg38.expansionhunter.json | 0 .../catalogs/STRchive-disease-loci.hg38.general.bed | 0 data/catalogs/STRchive-disease-loci.hg38.longTR.bed | 0 .../catalogs/STRchive-disease-loci.hg38.straglr.bed | 0 .../STRchive-disease-loci.hg38.stranger.json | 0 data/catalogs/STRchive-disease-loci.hg38.strkit.bed | 0 data/catalogs/STRchive-disease-loci.hg38.ucsc.bb | Bin data/catalogs/STRchive-disease-loci.hg38.ucsc.bed | 0 20 files changed, 0 insertions(+), 0 deletions(-) mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg19.atarva.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg19.longTR.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg19.straglr.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg19.stranger.json mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg19.strkit.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg19.ucsc.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.atarva.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.general.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.longTR.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.straglr.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.stranger.json mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.strkit.bed mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.ucsc.bb mode change 100755 => 100644 data/catalogs/STRchive-disease-loci.hg38.ucsc.bed diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg19.atarva.bed b/data/catalogs/STRchive-disease-loci.hg19.atarva.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg19.longTR.bed b/data/catalogs/STRchive-disease-loci.hg19.longTR.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg19.straglr.bed b/data/catalogs/STRchive-disease-loci.hg19.straglr.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg19.strkit.bed b/data/catalogs/STRchive-disease-loci.hg19.strkit.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg19.ucsc.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi b/data/catalogs/STRchive-disease-loci.hg38.atarva.bed.gz.tbi old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json b/data/catalogs/STRchive-disease-loci.hg38.expansionhunter.json old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.general.bed b/data/catalogs/STRchive-disease-loci.hg38.general.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.longTR.bed b/data/catalogs/STRchive-disease-loci.hg38.longTR.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.straglr.bed b/data/catalogs/STRchive-disease-loci.hg38.straglr.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.stranger.json b/data/catalogs/STRchive-disease-loci.hg38.stranger.json old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.strkit.bed b/data/catalogs/STRchive-disease-loci.hg38.strkit.bed old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bb b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bb old mode 100755 new mode 100644 diff --git a/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed b/data/catalogs/STRchive-disease-loci.hg38.ucsc.bed old mode 100755 new mode 100644