Skip to content

Clean up disease IDs, and change how HPO terms are sourced #523

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Merged
hdashnow merged 18 commits into from
Oct 8, 2026
Merged

Clean up disease IDs, and change how HPO terms are sourced #523

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
18 commits
Select commit Hold shift + click to select a range
be634c1
add missing mondo ids and fix mondo id for FRDA + regenerate HPO terms
hdashnow Oct 2, 2026
2b4f323
add HPO terms for new mondo ids
hdashnow Oct 2, 2026
1938846
Update MONDO/OMIM and HPO annotations for FTDALS1_C9orf72, ALS1_NIPA1…
hdashnow Oct 2, 2026
bf0e844
added autism mondo id to FRA7A_ZNF713 and updated hpo terms
hdashnow Oct 2, 2026
22ea78d
Use the more specific MONDO ID for FRDA_FXN
hdashnow Oct 2, 2026
53c852e
Fetch HPO terms from HPO annotations using OMIM and Orphanet IDs
hdashnow Oct 2, 2026
aa584df
Update Orphanet and OMIM cross-references
hdashnow Oct 2, 2026
63e0d10
Regenerate HPO terms from OMIM and Orphanet annotations
hdashnow Oct 2, 2026
518c2a1
Rename SD5_HOXD13 to SPD1_HOXD13
hdashnow Oct 2, 2026
f14a9ee
Add omim_gene field and keep omim for disease entries
hdashnow Oct 2, 2026
c16dab2
Align criTRia curations with STRchive loci
hdashnow Oct 2, 2026
574662f
Update data
hdashnow Oct 3, 2026
7d49a63
Use HSAN-VIII as the disease ID for HSAN-VIII_PRDM12
hdashnow Oct 3, 2026
92e09c2
Update data
hdashnow Oct 3, 2026
621e3e7
rename ALS1_NIPA1 -> ALS_NIPA1
hdashnow Oct 4, 2026
2b82835
Update data
hdashnow Oct 4, 2026
7acf15f
increment version
hdashnow Oct 7, 2026
daf3bde
Update data
hdashnow Oct 7, 2026
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
4 changes: 2 additions & 2 deletions CITATION.cff
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,6 +1,6 @@
title: STRchive
version: 2.27.0
date-released: "2026-09-30"
version: 2.28.0
date-released: "2026-10-07"
url: https://github.com/dashnowlab/STRchive
authors:
- family-names: Dashnow
Expand Down
212 changes: 147 additions & 65 deletions data/STRchive-loci.json
View file
Open in desktop

Large diffs are not rendered by default.

18 changes: 16 additions & 2 deletions data/STRchive-loci.schema.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -166,7 +166,7 @@
"hpo_terms": {
"section": "Disease",
"title": "HPO Terms",
"description": "Human Phenotype Ontology (HPO) terms associated with the disease",
"description": "Human Phenotype Ontology (HPO) terms associated with the disease. Populated automatically by scripts/getHPO.py from the HPO annotations (phenotype.hpoa) for the locus's OMIM and Orphanet IDs: all OMIM annotations, plus Orphanet annotations seen in at least 5% of patients (frequency occasional or higher). Excludes terms annotated as absent (NOT).",
"examples": ["HP:0002066 Gait ataxia", "HP:0001250 Seizure"],
"type": ["array", "null"],
"items": {
Expand Down Expand Up @@ -604,7 +604,7 @@
"omim": {
"section": "IDs",
"title": "OMIM",
"description": "OMIM ID(s) for the disease",
"description": "OMIM phenotype ID(s) for the disease. Leave empty if OMIM has no phenotype entry; gene entries go in omim_gene",
"examples": ["614575"],
"uri-template": "https://omim.org/entry/{id}",
"type": "array",
Expand All @@ -614,6 +614,19 @@
"type": ["string"]
}
},
"omim_gene": {
"section": "IDs",
"title": "OMIM Gene",
"description": "OMIM gene ID(s) for the gene containing the locus. Populated from HGNC by scripts/getOMIMgene.py",
"examples": ["601464"],
"uri-template": "https://omim.org/entry/{id}",
"type": "array",
"uniqueItems": true,
"items": {
"title": "",
"type": ["string"]
}
},
"orphanet": {
"section": "IDs",
"title": "Orphanet",
Expand Down Expand Up @@ -827,6 +840,7 @@
"medgen",
"mondo",
"omim",
"omim_gene",
"orphanet",
"gnomad",
"stripy",
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -6,7 +6,7 @@ chr1 154328121 154330802 ID=ADTKD_MUC1;MOTIFS=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGG
chr1 155728131 155728159 ID=NME_NAXE;MOTIFS=CCGGG,GGGCC;STRUC=<TR>
chr2 96703674 96703732 ID=FAME2_STARD7;MOTIFS=AAATG,AAAAT,TGAAA;STRUC=<TR>
chr2 100563685 100563738 ID=FRA2A_AFF3;MOTIFS=CCG;STRUC=<TR>
chr2 176581179 176581224 ID=SD5_HOXD13;MOTIFS=GCN;STRUC=<TR>
chr2 176581179 176581224 ID=SPD1_HOXD13;MOTIFS=GCN;STRUC=<TR>
chr2 191369982 191370024 ID=GDPAG_GLS;MOTIFS=CAG;STRUC=<TR>
chr3 63956302 63956345 ID=SCA7_ATXN7;MOTIFS=CAG,CCG;STRUC=<TR>
chr3 131917482 131917635 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC=<TR>
Expand Down Expand Up @@ -45,7 +45,7 @@ chr13 99196358 99196404 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC=<TR>
chr13 101377549 101377792 ID=SCA27B_FGF14;MOTIFS=AAG,GAA,AGG,CAG;STRUC=<TR>
chr14 17522488 17522519 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC=<TR>
chr14 86300519 86300603 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC=<TR>
chr15 20458510 20458536 ID=ALS1_NIPA1;MOTIFS=CGG;STRUC=<TR>
chr15 20458510 20458536 ID=ALS_NIPA1;MOTIFS=CGG;STRUC=<TR>
chr15 32225152 32225178 ID=aFTLD-U_GOLGA8A;MOTIFS=CT,TTTC,CCTT,CCCTCT;STRUC=<TR>
chr15 86324038 86324057 ID=CHNG3_MIR7-2;MOTIFS=GTTT,TTTG;STRUC=<TR>
chr15 87088402 87088452 ID=CPEO_POLG;MOTIFS=GCT,GTT,CTG;STRUC=<TR>
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -7,7 +7,7 @@ chr1 154328121 154330802 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC
chr1 155728131 155728159 CCGGG 5 NME_NAXE
chr2 96703674 96703677 AAATG 5 FAME2_STARD7
chr2 100563685 100563738 CCG 3 FRA2A_AFF3
chr2 176581179 176581224 GCN 3 SD5_HOXD13
chr2 176581179 176581224 GCN 3 SPD1_HOXD13
chr2 191369982 191370024 CAG 3 GDPAG_GLS
chr3 63956302 63956333 CAG 3 SCA7_ATXN7
chr3 63956333 63956345 CCG 3 SCA7_ATXN7_flank
Expand Down Expand Up @@ -53,7 +53,7 @@ chr13 99196358 99196404 GCN 3 HPE5_ZIC2
chr13 101377549 101377792 AAG 3 SCA27B_FGF14
chr14 17522488 17522519 GCN 3 OPMD_PABPN1
chr14 86300519 86300603 CTG 3 SCA3_ATXN3
chr15 20458510 20458536 CGG 3 ALS1_NIPA1
chr15 20458510 20458536 CGG 3 ALS_NIPA1
chr15 32225152 32225178 CT 2 aFTLD-U_GOLGA8A
chr15 86324038 86324057 GTTT 4 CHNG3_MIR7-2
chr15 87088402 87088408 GCT 3 CPEO_POLG_flank
Expand Down
Binary file modified data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz
View file
Open in desktop
Binary file not shown.
Binary file modified data/catalogs/STRchive-disease-loci.T2T-chm13.atarva.bed.gz.tbi
View file
Open in desktop
Binary file not shown.
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.expansionhunter.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -48,7 +48,7 @@
"VariantType": "Repeat"
},
{
"LocusId": "SD5_HOXD13",
"LocusId": "SPD1_HOXD13",
"LocusStructure": "(GCN)*",
"ReferenceRegion": "chr2:176581179-176581224",
"VariantType": "Repeat"
Expand Down Expand Up @@ -282,7 +282,7 @@
"VariantType": "Repeat"
},
{
"LocusId": "ALS1_NIPA1",
"LocusId": "ALS_NIPA1",
"LocusStructure": "(CGG)*",
"ReferenceRegion": "chr15:20458510-20458536",
"VariantType": "Repeat"
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -7,7 +7,7 @@ chr1 154328121 154330802 ADTKD_MUC1 MUC1 GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTC
chr1 155728131 155728159 NME_NAXE NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy
chr2 96703674 96703732 FAME2_STARD7 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2
chr2 100563685 100563738 FRA2A_AFF3 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A
chr2 176581179 176581224 SD5_HOXD13 HOXD13 GCN GCN 22 AD Syndactyly
chr2 176581179 176581224 SPD1_HOXD13 HOXD13 GCN GCN 22 AD Synpolydactyly 1
chr2 191369982 191370024 GDPAG_GLS GLS CAG CAG 680 AR Glutaminase deficiency
chr3 63956302 63956333 SCA7_ATXN7 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7
chr3 131917482 131917557 DM2_CNBP CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2
Expand Down Expand Up @@ -46,7 +46,7 @@ chr13 99196358 99196404 HPE5_ZIC2 ZIC2 GCN GCN 25 AD Holoprosencephaly-5
chr13 101377549 101377792 SCA27B_FGF14 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B
chr14 17522488 17522519 OPMD_PABPN1 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy
chr14 86300519 86300603 SCA3_ATXN3 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease
chr15 20458510 20458536 ALS1_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis
chr15 20458510 20458536 ALS_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis
chr15 32225152 32225178 aFTLD-U_GOLGA8A GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U)
chr15 86324038 86324057 CHNG3_MIR7-2 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3
chr15 87088411 87088452 CPEO_POLG POLG CTG CTG None Progressive external ophthalmoplegia, Parkinson's disease
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.longTR.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -6,7 +6,7 @@ chr1 154328122 154330802 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC
chr1 155728132 155728159 CCGGG,GGGCC NME_NAXE
chr2 96703675 96703732 TGAAA,AAAAT FAME2_STARD7
chr2 100563686 100563738 CCG FRA2A_AFF3
chr2 176581180 176581224 GCN SD5_HOXD13
chr2 176581180 176581224 GCN SPD1_HOXD13
chr2 191369983 191370024 CAG GDPAG_GLS
chr3 63956303 63956333 CAG SCA7_ATXN7
chr3 131917483 131917557 CAGG DM2_CNBP
Expand Down Expand Up @@ -45,7 +45,7 @@ chr13 99196359 99196404 GCN HPE5_ZIC2
chr13 101377550 101377792 AAG,AGG,CAG,GAA SCA27B_FGF14
chr14 17522489 17522519 GCN OPMD_PABPN1
chr14 86300520 86300603 CTG SCA3_ATXN3
chr15 20458511 20458536 CGG ALS1_NIPA1
chr15 20458511 20458536 CGG ALS_NIPA1
chr15 32225153 32225178 CT,CCTT,CCCTCT,TTTC aFTLD-U_GOLGA8A
chr15 86324039 86324057 GTTT,TTTG CHNG3_MIR7-2
chr15 87088412 87088452 CTG CPEO_POLG
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.straglr.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -5,7 +5,7 @@ chr1 148519695 148519738 CGG NIID_NOTCH2NLC NIID_NOTCH2NLC
chr1 155728131 155728159 CCGGG NME_NAXE NME_NAXE
chr2 96703674 96703677 AAATG FAME2_STARD7 FAME2_STARD7
chr2 100563685 100563738 CCG FRA2A_AFF3 FRA2A_AFF3
chr2 176581179 176581224 GCN SD5_HOXD13 SD5_HOXD13
chr2 176581179 176581224 GCN SPD1_HOXD13 SPD1_HOXD13
chr2 191369982 191370024 CAG GDPAG_GLS GDPAG_GLS
chr3 63956302 63956333 CAG SCA7_ATXN7 SCA7_ATXN7
chr3 63956333 63956345 CCG SCA7_ATXN7 SCA7_ATXN7_CCG
Expand Down Expand Up @@ -50,7 +50,7 @@ chr13 99196358 99196404 GCN HPE5_ZIC2 HPE5_ZIC2
chr13 101377549 101377792 AAG SCA27B_FGF14 SCA27B_FGF14
chr14 17522488 17522519 GCN OPMD_PABPN1 OPMD_PABPN1
chr14 86300519 86300603 CTG SCA3_ATXN3 SCA3_ATXN3
chr15 20458510 20458536 CGG ALS1_NIPA1 ALS1_NIPA1
chr15 20458510 20458536 CGG ALS_NIPA1 ALS_NIPA1
chr15 32225152 32225178 CT aFTLD-U_GOLGA8A aFTLD-U_GOLGA8A
chr15 86324038 86324057 GTTT CHNG3_MIR7-2 CHNG3_MIR7-2
chr15 87088402 87088408 GCT CPEO_POLG CPEO_POLG_GCT
Expand Down
10 changes: 5 additions & 5 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -95,14 +95,14 @@
"Gene": "AFF3"
},
{
"LocusId": "SD5_HOXD13",
"LocusId": "SPD1_HOXD13",
"ReferenceRegion": "chr2:176581179-176581224",
"LocusStructure": "(GCN)*",
"VariantType": "Repeat",
"HGNCId": null,
"InheritanceMode": ["AD"],
"DisplayRU": "GCN",
"Disease": "SD5",
"Disease": "SPD1",
"NormalMax": 15,
"PathologicMin": 22,
"Gene": "HOXD13"
Expand Down Expand Up @@ -447,7 +447,7 @@
"HGNCId": null,
"InheritanceMode": ["AR"],
"DisplayRU": "CCG",
"Disease": "HSAN VIII",
"Disease": "HSAN-VIII",
"NormalMax": 14,
"PathologicMin": 18,
"Gene": "PRDM12"
Expand Down Expand Up @@ -611,14 +611,14 @@
"Gene": "ATXN3"
},
{
"LocusId": "ALS1_NIPA1",
"LocusId": "ALS_NIPA1",
"ReferenceRegion": "chr15:20458510-20458536",
"LocusStructure": "(CGG)*",
"VariantType": "Repeat",
"HGNCId": null,
"InheritanceMode": ["AD"],
"DisplayRU": "CGG",
"Disease": "ALS1",
"Disease": "ALS",
"NormalMax": 10,
"PathologicMin": 11,
"Gene": "NIPA1"
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.strkit.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -6,7 +6,7 @@ chr1 154328121 154330802 ID=ADTKD_MUC1;MOTIF=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGC
chr1 155728131 155728159 ID=NME_NAXE;MOTIF=CCGGG
chr2 96703674 96703732 ID=FAME2_STARD7;MOTIF=TGAAA
chr2 100563685 100563738 ID=FRA2A_AFF3;MOTIF=CCG
chr2 176581179 176581224 ID=SD5_HOXD13;MOTIF=GCN
chr2 176581179 176581224 ID=SPD1_HOXD13;MOTIF=GCN
chr2 191369982 191370024 ID=GDPAG_GLS;MOTIF=CAG
chr3 63956302 63956333 ID=SCA7_ATXN7;MOTIF=CAG
chr3 131917482 131917557 ID=DM2_CNBP;MOTIF=CAGG
Expand Down Expand Up @@ -45,7 +45,7 @@ chr13 99196358 99196404 ID=HPE5_ZIC2;MOTIF=GCN
chr13 101377549 101377792 ID=SCA27B_FGF14;MOTIF=AAG
chr14 17522488 17522519 ID=OPMD_PABPN1;MOTIF=GCN
chr14 86300519 86300603 ID=SCA3_ATXN3;MOTIF=CTG
chr15 20458510 20458536 ID=ALS1_NIPA1;MOTIF=CGG
chr15 20458510 20458536 ID=ALS_NIPA1;MOTIF=CGG
chr15 32225152 32225178 ID=aFTLD-U_GOLGA8A;MOTIF=CT
chr15 86324038 86324057 ID=CHNG3_MIR7-2;MOTIF=GTTT
chr15 87088411 87088452 ID=CPEO_POLG;MOTIF=CTG
Expand Down
Binary file modified data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bb
View file
Open in desktop
Binary file not shown.
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.T2T-chm13.ucsc.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -6,7 +6,7 @@ chr1 154328121 154330802 ADTKD_MUC1 0 - 154328121 154330802 0,128,0 MUC1 GGCTNNG
chr1 155728131 155728159 NME_NAXE 0 + 155728131 155728159 230,145,0 NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy Limited
chr2 96703674 96703732 FAME2_STARD7 0 - 96703674 96703732 64,160,0 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2 Strong
chr2 100563685 100563738 FRA2A_AFF3 0 - 100563685 100563738 0,128,0 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A Definitive
chr2 176581179 176581224 SD5_HOXD13 0 + 176581179 176581224 0,128,0 HOXD13 GCN GCN 22 AD Syndactyly Definitive
chr2 176581179 176581224 SPD1_HOXD13 0 + 176581179 176581224 0,128,0 HOXD13 GCN GCN 22 AD Synpolydactyly 1 Definitive
chr2 191369982 191370024 GDPAG_GLS 0 + 191369982 191370024 0,128,0 GLS CAG CAG 680 AR Glutaminase deficiency Definitive
chr3 63956302 63956333 SCA7_ATXN7 0 + 63956302 63956333 0,128,0 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7 Definitive
chr3 131917482 131917557 DM2_CNBP 0 - 131917482 131917557 0,128,0 CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2 Definitive
Expand Down Expand Up @@ -45,7 +45,7 @@ chr13 99196358 99196404 HPE5_ZIC2 0 + 99196358 99196404 0,128,0 ZIC2 GCN GCN 25
chr13 101377549 101377792 SCA27B_FGF14 0 - 101377549 101377792 0,128,0 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B Definitive
chr14 17522488 17522519 OPMD_PABPN1 0 + 17522488 17522519 0,128,0 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy Definitive
chr14 86300519 86300603 SCA3_ATXN3 0 - 86300519 86300603 0,128,0 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease Definitive
chr15 20458510 20458536 ALS1_NIPA1 0 + 20458510 20458536 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed
chr15 20458510 20458536 ALS_NIPA1 0 + 20458510 20458536 200,0,0 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis Disputed
chr15 32225152 32225178 aFTLD-U_GOLGA8A 0 - 32225152 32225178 128,128,128 GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U) Provisional
chr15 86324038 86324057 CHNG3_MIR7-2 0 - 86324038 86324057 64,160,0 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3 Strong
chr15 87088411 87088452 CPEO_POLG 0 - 87088411 87088452 200,0,0 POLG CTG CTG . Progressive external ophthalmoplegia, Parkinson's disease Disputed
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.hg19.TRGT.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -6,7 +6,7 @@ chr1 155160981 155162030 ID=ADTKD_MUC1;MOTIFS=CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGG
chr1 156561557 156561575 ID=NME_NAXE;MOTIFS=CCGGG,GGGCC;STRUC=<TR>
chr2 96862804 96862862 ID=FAME2_STARD7;MOTIFS=AAATG,AAAAT,TGAAA;STRUC=<TR>
chr2 100721260 100721286 ID=FRA2A_AFF3;MOTIFS=CCG;STRUC=<TR>
chr2 176957786 176957831 ID=SD5_HOXD13;MOTIFS=GCN;STRUC=<TR>
chr2 176957786 176957831 ID=SPD1_HOXD13;MOTIFS=GCN;STRUC=<TR>
chr2 191745598 191745646 ID=GDPAG_GLS;MOTIFS=CAG;STRUC=<TR>
chr3 63898360 63898403 ID=SCA7_ATXN7;MOTIFS=CAG,CCG;STRUC=<TR>
chr3 128891419 128891577 ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC=<TR>
Expand Down Expand Up @@ -45,7 +45,7 @@ chr13 100637702 100637748 ID=HPE5_ZIC2;MOTIFS=GCN;STRUC=<TR>
chr13 102813924 102814076 ID=SCA27B_FGF14;MOTIFS=AAG,GAA,AGG,CAG;STRUC=<TR>
chr14 23790681 23790712 ID=OPMD_PABPN1;MOTIFS=GCN;STRUC=<TR>
chr14 92537354 92537396 ID=SCA3_ATXN3;MOTIFS=CTG;STRUC=<TR>
chr15 23086363 23086389 ID=ALS1_NIPA1;MOTIFS=CGG;STRUC=<TR>
chr15 23086363 23086389 ID=ALS_NIPA1;MOTIFS=CGG;STRUC=<TR>
chr15 34711626 34711652 ID=aFTLD-U_GOLGA8A;MOTIFS=CT,TTTC,CCTT,CCCTCT;STRUC=<TR>
chr15 89112664 89112683 ID=CHNG3_MIR7-2;MOTIFS=GTTT,TTTG;STRUC=<TR>
chr15 89876810 89876860 ID=CPEO_POLG;MOTIFS=GCT,GTT,CTG;STRUC=<TR>
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.hg19.atarva.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -7,7 +7,7 @@ chr1 155160981 155162030 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC
chr1 156561557 156561575 CCGGG 5 NME_NAXE
chr2 96862804 96862807 AAATG 5 FAME2_STARD7
chr2 100721260 100721286 CCG 3 FRA2A_AFF3
chr2 176957786 176957831 GCN 3 SD5_HOXD13
chr2 176957786 176957831 GCN 3 SPD1_HOXD13
chr2 191745598 191745646 CAG 3 GDPAG_GLS
chr3 63898360 63898391 CAG 3 SCA7_ATXN7
chr3 63898391 63898403 CCG 3 SCA7_ATXN7_flank
Expand Down Expand Up @@ -53,7 +53,7 @@ chr13 100637702 100637748 GCN 3 HPE5_ZIC2
chr13 102813924 102814076 AAG 3 SCA27B_FGF14
chr14 23790681 23790712 GCN 3 OPMD_PABPN1
chr14 92537354 92537396 CTG 3 SCA3_ATXN3
chr15 23086363 23086389 CGG 3 ALS1_NIPA1
chr15 23086363 23086389 CGG 3 ALS_NIPA1
chr15 34711626 34711652 CT 2 aFTLD-U_GOLGA8A
chr15 89112664 89112683 GTTT 4 CHNG3_MIR7-2
chr15 89876810 89876816 GCT 3 CPEO_POLG_flank
Expand Down
Binary file modified data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz
View file
Open in desktop
Binary file not shown.
Binary file modified data/catalogs/STRchive-disease-loci.hg19.atarva.bed.gz.tbi
View file
Open in desktop
Binary file not shown.
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.hg19.expansionhunter.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -48,7 +48,7 @@
"VariantType": "Repeat"
},
{
"LocusId": "SD5_HOXD13",
"LocusId": "SPD1_HOXD13",
"LocusStructure": "(GCN)*",
"ReferenceRegion": "chr2:176957786-176957831",
"VariantType": "Repeat"
Expand Down Expand Up @@ -282,7 +282,7 @@
"VariantType": "Repeat"
},
{
"LocusId": "ALS1_NIPA1",
"LocusId": "ALS_NIPA1",
"LocusStructure": "(CGG)*",
"ReferenceRegion": "chr15:23086363-23086389",
"VariantType": "Repeat"
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.hg19.general.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -7,7 +7,7 @@ chr1 155160981 155162030 ADTKD_MUC1 MUC1 GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTC
chr1 156561557 156561575 NME_NAXE NAXE GGGCC CCGGG 200 AR NAXE-related mitochondrial encephalopathy
chr2 96862804 96862862 FAME2_STARD7 STARD7 AAAAT TGAAA 274 AD Familial adult myoclonic epilepsy 2
chr2 100721260 100721286 FRA2A_AFF3 AFF3 CCG CCG 300 AD Intellectual disability associated with fragile site FRA2A
chr2 176957786 176957831 SD5_HOXD13 HOXD13 GCN GCN 22 AD Syndactyly
chr2 176957786 176957831 SPD1_HOXD13 HOXD13 GCN GCN 22 AD Synpolydactyly 1
chr2 191745598 191745646 GDPAG_GLS GLS CAG CAG 680 AR Glutaminase deficiency
chr3 63898360 63898391 SCA7_ATXN7 ATXN7 CAG CAG 37 AD Spinocerebellar ataxia type 7
chr3 128891419 128891499 DM2_CNBP CNBP CAGG CAGG 75 AD Myotonic dystrophy type 2
Expand Down Expand Up @@ -46,7 +46,7 @@ chr13 100637702 100637748 HPE5_ZIC2 ZIC2 GCN GCN 25 AD Holoprosencephaly-5
chr13 102813924 102814076 SCA27B_FGF14 FGF14 GAA AAG 320 AD Spinocerebellar ataxia 27B
chr14 23790681 23790712 OPMD_PABPN1 PABPN1 GCN GCN 12 AD,AR Oculopharyngeal muscular dystrophy
chr14 92537354 92537396 SCA3_ATXN3 ATXN3 CTG CTG 60 AD Spinocerebellar ataxia type 3/Machado-Joseph disease
chr15 23086363 23086389 ALS1_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis
chr15 23086363 23086389 ALS_NIPA1 NIPA1 CGG CGG 11 AD Amyotrophic lateral sclerosis
chr15 34711626 34711652 aFTLD-U_GOLGA8A GOLGA8A TTTC CT 190 Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U)
chr15 89112664 89112683 CHNG3_MIR7-2 MIR7-2 TTTG GTTT 3 AD Nongoitrous congenital hypothyroidism-3
chr15 89876819 89876860 CPEO_POLG POLG CTG CTG None Progressive external ophthalmoplegia, Parkinson's disease
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.hg19.longTR.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -6,7 +6,7 @@ chr1 155160982 155162030 CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCC
chr1 156561558 156561575 CCGGG,GGGCC NME_NAXE
chr2 96862805 96862862 TGAAA,AAAAT FAME2_STARD7
chr2 100721261 100721286 CCG FRA2A_AFF3
chr2 176957787 176957831 GCN SD5_HOXD13
chr2 176957787 176957831 GCN SPD1_HOXD13
chr2 191745599 191745646 CAG GDPAG_GLS
chr3 63898361 63898391 CAG SCA7_ATXN7
chr3 128891420 128891499 CAGG DM2_CNBP
Expand Down Expand Up @@ -45,7 +45,7 @@ chr13 100637703 100637748 GCN HPE5_ZIC2
chr13 102813925 102814076 AAG,AGG,CAG,GAA SCA27B_FGF14
chr14 23790682 23790712 GCN OPMD_PABPN1
chr14 92537355 92537396 CTG SCA3_ATXN3
chr15 23086364 23086389 CGG ALS1_NIPA1
chr15 23086364 23086389 CGG ALS_NIPA1
chr15 34711627 34711652 CT,CCTT,CCCTCT,TTTC aFTLD-U_GOLGA8A
chr15 89112665 89112683 GTTT,TTTG CHNG3_MIR7-2
chr15 89876820 89876860 CTG CPEO_POLG
Expand Down
4 changes: 2 additions & 2 deletions data/catalogs/STRchive-disease-loci.hg19.straglr.bed
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -5,7 +5,7 @@ chr1 145209323 145209354 CGG NIID_NOTCH2NLC NIID_NOTCH2NLC
chr1 156561557 156561575 CCGGG NME_NAXE NME_NAXE
chr2 96862804 96862807 AAATG FAME2_STARD7 FAME2_STARD7
chr2 100721260 100721286 CCG FRA2A_AFF3 FRA2A_AFF3
chr2 176957786 176957831 GCN SD5_HOXD13 SD5_HOXD13
chr2 176957786 176957831 GCN SPD1_HOXD13 SPD1_HOXD13
chr2 191745598 191745646 CAG GDPAG_GLS GDPAG_GLS
chr3 63898360 63898391 CAG SCA7_ATXN7 SCA7_ATXN7
chr3 63898391 63898403 CCG SCA7_ATXN7 SCA7_ATXN7_CCG
Expand Down Expand Up @@ -50,7 +50,7 @@ chr13 100637702 100637748 GCN HPE5_ZIC2 HPE5_ZIC2
chr13 102813924 102814076 AAG SCA27B_FGF14 SCA27B_FGF14
chr14 23790681 23790712 GCN OPMD_PABPN1 OPMD_PABPN1
chr14 92537354 92537396 CTG SCA3_ATXN3 SCA3_ATXN3
chr15 23086363 23086389 CGG ALS1_NIPA1 ALS1_NIPA1
chr15 23086363 23086389 CGG ALS_NIPA1 ALS_NIPA1
chr15 34711626 34711652 CT aFTLD-U_GOLGA8A aFTLD-U_GOLGA8A
chr15 89112664 89112683 GTTT CHNG3_MIR7-2 CHNG3_MIR7-2
chr15 89876810 89876816 GCT CPEO_POLG CPEO_POLG_GCT
Expand Down
10 changes: 5 additions & 5 deletions data/catalogs/STRchive-disease-loci.hg19.stranger.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -95,14 +95,14 @@
"Gene": "AFF3"
},
{
"LocusId": "SD5_HOXD13",
"LocusId": "SPD1_HOXD13",
"ReferenceRegion": "chr2:176957786-176957831",
"LocusStructure": "(GCN)*",
"VariantType": "Repeat",
"HGNCId": null,
"InheritanceMode": ["AD"],
"DisplayRU": "GCN",
"Disease": "SD5",
"Disease": "SPD1",
"NormalMax": 15,
"PathologicMin": 22,
"Gene": "HOXD13"
Expand Down Expand Up @@ -447,7 +447,7 @@
"HGNCId": null,
"InheritanceMode": ["AR"],
"DisplayRU": "CCG",
"Disease": "HSAN VIII",
"Disease": "HSAN-VIII",
"NormalMax": 14,
"PathologicMin": 18,
"Gene": "PRDM12"
Expand Down Expand Up @@ -611,14 +611,14 @@
"Gene": "ATXN3"
},
{
"LocusId": "ALS1_NIPA1",
"LocusId": "ALS_NIPA1",
"ReferenceRegion": "chr15:23086363-23086389",
"LocusStructure": "(CGG)*",
"VariantType": "Repeat",
"HGNCId": null,
"InheritanceMode": ["AD"],
"DisplayRU": "CGG",
"Disease": "ALS1",
"Disease": "ALS",
"NormalMax": 10,
"PathologicMin": 11,
"Gene": "NIPA1"
Expand Down
Loading
Loading