verify approaches

bin/.test-in-docker

@@ -6,29 +6,45 @@ all_slugs="$*"
 
 exit_code=0
 
+# Runs the tests against /tmp/solution/${snake}.zig, recording any failure
+# under the given description.
+check_solution() {
+  bin/run.sh "${slug}" /tmp/solution /tmp/solution > /dev/null
+  if ! jq -e '.status == "pass"' /tmp/solution/results.json > /dev/null; then
+    # A compile error reports at the top level; failing tests report per test.
+    errors="${errors}\n\n${1} is incorrect:\n$(jq -r '
+      .message
+      // ([.tests[]? | select(.status != "pass") | "\(.name):\n\(.message // "no message")"] | join("\n\n"))
+    ' /tmp/solution/results.json)"
+    local_exit_code=1;
+  fi
+}
+
 for slug in $all_slugs; do
   snake="${slug//-/_}"
   local_exit_code=0
 
   rm -rf /tmp/solution
   cp -r "/exercises/practice/${slug}" /tmp/solution
 
+  errors=""
+
   # Integration test: Check if the example solution passes the tests
   # as run by the zig-test-runner similiarly to a student submitting
   # their solution.
   cp /tmp/solution/.meta/example.zig "/tmp/solution/${snake}.zig"
-  bin/run.sh "${slug}" /tmp/solution /tmp/solution > /dev/null
-
-  errors=""
-
-  if ! jq -e '.status == "pass"' /tmp/solution/results.json > /dev/null; then
-    # A compile error reports at the top level; failing tests report per test.
-    errors="${errors}\n\nSolution is incorrect:\n$(jq -r '
-      .message
-      // ([.tests[]? | select(.status != "pass") | "\(.name):\n\(.message // "no message")"] | join("\n\n"))
-    ' /tmp/solution/results.json)"
-    local_exit_code=1;
-  fi
+  check_solution "Solution"
+
+  # Approach docs: by convention, the first ```zig block in each
+  # approach's content.md is a complete solution, so it must also pass.
+  for content in "/exercises/practice/${slug}"/.approaches/*/content.md; do
+    [ -e "${content}" ] || continue
+    approach=$(basename "$(dirname "${content}")")
+    awk '/^```zig$/ && !found { in_block = 1; found = 1; next }
+         in_block && /^```$/ { exit }
+         in_block { print }' "${content}" > "/tmp/solution/${snake}.zig"
+    check_solution "Approach ${approach} solution"
+  done
 
   if [ $local_exit_code = 0 ]; then
     echo -e "${slug}: \e[32mPASSED\e[0m"

bin/run-tests

@@ -20,6 +20,19 @@ execute_test() {
       printf '%s\n' "Error: ${exercise_name} lacks its '.meta/example.zig' file" >&2
       exit 1
     fi
+
+    # Approach docs: by convention, the first ```zig block in each
+    # approach's content.md is a complete solution, so it must also pass.
+    local content
+    for content in .approaches/*/content.md; do
+      [[ -e "${content}" ]] || continue
+      printf '%s\n' "Running tests for ${1} approach $(basename "$(dirname "${content}")")..." >&2
+      awk '/^```zig$/ && !found { in_block = 1; found = 1; next }
+           in_block && /^```$/ { exit }
+           in_block { print }' "${content}" > "${exercise_name}".zig
+      zig test "test_${exercise_name}.zig"
+      printf '\n' >&2
+    done
   )
 }
 

bin/verify-exercises-in-docker

@@ -49,6 +49,27 @@ run_tests() {
     jq -e '.status == "pass"' "${PWD}/results.json" >/dev/null 2>&1
 }
 
+first_zig_block() {
+    awk '/^```zig$/ && !found { in_block = 1; found = 1; next }
+         in_block && /^```$/ { exit }
+         in_block { print }' "${1}"
+}
+
+verify_approaches() {
+    local slug content approach solution
+    slug="${1}"
+    solution=$(jq -r '.files.solution[0]' .meta/config.json)
+
+    # Approach docs: by convention, the first ```zig block in each
+    # approach's content.md is a complete solution, so it must also pass.
+    for content in .approaches/*/content.md; do
+        approach=$(basename "$(dirname "${content}")")
+        echo "Verifying ${slug} approach: ${approach}..."
+        first_zig_block "${content}" > "${solution}"
+        run_tests "${slug}" || { cat results.json; return 1; }
+    done
+}
+
 verify_exercise() {
     local dir
     local slug
@@ -66,6 +87,7 @@ verify_exercise() {
 
         copy_example_or_examplar_to_solution
         run_tests "${slug}" || { cat "${tmp_dir}/results.json"; exit 1; }
+        verify_approaches "${slug}" || exit 1
     )
 }
 

exercises/practice/isogram/.meta/supplements.json

@@ -0,0 +1,31 @@
+{
+  "cases": [
+    {
+      "description": "long isogram with spaces and hyphens",
+      "property": "isIsogram",
+      "comment": "151 bytes: more than two SIMD blocks of 64 bytes (AVX-512), with a partial block left over for 8, 16, 32 and 64 lanes.",
+      "input": {
+        "phrase": "a - - B - - c - - D - - e - - F - - g - - H - - i - - J - - k - - L - - m - - N - - o - - P - - q - - R - - s - - T - - u - - V - - w - - X - - y - - Z"
+      },
+      "expected": true
+    },
+    {
+      "description": "long phrase with duplicated character in mixed case",
+      "property": "isIsogram",
+      "comment": "The duplicates are at bytes 0 and 102, so a SIMD solution sees them in different full blocks for 8, 16, 32 and 64 lanes.",
+      "input": {
+        "phrase": "a - - B - - c - - D - - e - - F - - g - - H - - i - - J - - k - - L - - m - - N - - o - - P - - q - - A - - s - - T - - u - - V - - w - - X - - y - - Z"
+      },
+      "expected": false
+    },
+    {
+      "description": "long phrase with first letter repeated at the end",
+      "property": "isIsogram",
+      "comment": "The duplicates are at bytes 0 and 150, so a SIMD solution sees the second one in the final partial block for 8, 16, 32 and 64 lanes.",
+      "input": {
+        "phrase": "a - - B - - c - - D - - e - - F - - g - - H - - i - - J - - k - - L - - m - - N - - o - - P - - q - - R - - s - - T - - u - - V - - w - - X - - y - - A"
+      },
+      "expected": false
+    }
+  ]
+}

exercises/practice/isogram/test_isogram.zig

@@ -62,3 +62,15 @@ test "same first and last characters" {
 test "word with duplicated character and with two hyphens" {
     try testIsIsogram("up-to-date", false);
 }
+
+test "long isogram with spaces and hyphens" {
+    try testIsIsogram("a - - B - - c - - D - - e - - F - - g - - H - - i - - J - - k - - L - - m - - N - - o - - P - - q - - R - - s - - T - - u - - V - - w - - X - - y - - Z", true);
+}
+
+test "long phrase with duplicated character in mixed case" {
+    try testIsIsogram("a - - B - - c - - D - - e - - F - - g - - H - - i - - J - - k - - L - - m - - N - - o - - P - - q - - A - - s - - T - - u - - V - - w - - X - - y - - Z", false);
+}
+
+test "long phrase with first letter repeated at the end" {
+    try testIsIsogram("a - - B - - c - - D - - e - - F - - g - - H - - i - - J - - k - - L - - m - - N - - o - - P - - q - - R - - s - - T - - u - - V - - w - - X - - y - - A", false);
+}

exercises/practice/rna-transcription/.meta/supplements.json

@@ -0,0 +1,13 @@
+{
+  "cases": [
+    {
+      "description": "long rna complement",
+      "property": "toRna",
+      "comment": "108 nucleotides: longer than a SIMD block of 64 bytes (AVX-512), with a partial block left over for 8, 16, 32 and 64 lanes.",
+      "input": {
+        "dna": "ACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAA"
+      },
+      "expected": "UGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUU"
+    }
+  ]
+}

exercises/practice/rna-transcription/test_rna_transcription.zig

@@ -33,3 +33,7 @@ test "rna complement of adenine is uracil" {
 test "rna complement" {
     try testTranscription("ACGTGGTCTTAA", "UGCACCAGAAUU");
 }
+
+test "long rna complement" {
+    try testTranscription("ACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAAACGTGGTCTTAA", "UGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUUUGCACCAGAAUU");
+}